Ифнс внесение изменений в егрюл: Внесение изменений в ЕГРЮЛ: пошаговая инструкция


Внесение изменений в учредительные документы ЮЛ

В течение «жизни» компании многое может измениться. Например, ее адрес, состав участников, виды деятельности. В некоторых случаях такие перемены требуют внесения изменений в Единый государственный реестр юридических лиц (ЕГРЮЛ).


Для внесения изменений в учредительные документы юридического лица в налоговые органы необходимо представить:


непосредственно в инспекцию — лично или через представителя по нотариально удостоверенной доверенности в многофункциональный центр — лично или через представителя по нотариально удостоверенной доверенности.


по почте с объявленной ценностью и описью вложения В пределах территории Москвы документы можно направить и получить также через DHL Express и Pony Express. в электронном виде c помощью сервиса: «Подача электронных документов на государственную регистрацию» Инспекция примет документы и выдаст (направит) расписку в их получении.


Если документы в порядке, то через 5 рабочих дней в инспекции лично или через представителя по нотариально удостоверенной доверенности можно получить:
  • лист записи ЕГРЮЛ;
  • экземпляр устава с отметкой регистрирующего органа.
Выписку из ЕГРЮЛ для банка и других организаций необходимо заказывать и оплачивать отдельно — сервис ЕГРЮЛ

Документы могут направить в ваш адрес и по почте. В пределах территории Москвы документ можно получить также через DHL Express и Pony Express.

Заявителями при регистрации могут выступать руководитель постоянно действующего исполнительного органа регистрируемого юридического лица или иное лицо, имеющие право без доверенности действовать от имени этого юридического лица, а также иное лицо, действующее на основании полномочия, предусмотренного федеральным законом, актом специально уполномоченного на то государственного органа или актом органа местного самоуправления.

Подпись заявителя должна быть засвидетельствована в нотариальном порядке.

При формировании электронного пакета образы документов должны быть отсканированы с учетом определенных технических требований и заверены вашей электронной цифровой подписью (ЭП), либо нотариуса.

Получить ЭП вы можете в специализированных центрах. Ключ электронной подписи должен быть действителен на момент подписания электронного документа и на день направления документов в налоговый орган.

Регистрирующий орган вправе отказать в регистрации. Исчерпывающий список причин для отказа приведен в п. 1 ст. 23 Федерального закона от 08.08.2001 № 129-ФЗ «О государственной регистрации юридических лиц и индивидуальных предпринимателей».

Регистрирующий орган вправе отказать в регистрации. Исчерпывающий список причин для отказа приведен в п. 1 ст. 23 Федерального закона от 08.08.2001 № 129-ФЗ «О государственной регистрации юридических лиц и индивидуальных предпринимателей».
Более 80% отказов в регистрации происходит по причине неверного заполнения регистрационной формы заявления ЮЛ.

Внесение изменений

Вся информация о юридических лицах и индивидуальных предпринимателях содержится в единых государственных реестрах юридических лиц (ЕГРЮЛ), и индивидуальных предпринимателей (ЕГРИП).

В процессе осуществления ими хозяйственной деятельности, происходят различного вида изменения в структуре предприятий и направлениях деятельности,  в связи с чем, возникает обязанность по внесению таковых изменений в государственный реестр.

Куда необходимо внести изменения?

Изменения в ЕГРЮЛ

Изменить сведения по ЮЛ

Готовность — 5 рабочих дней

Изменения в ЕГРИП

Изменить сведения по ИП

Готовность — 5 рабочих дней

Помощь в подготовке и государственной регистрации необходимых изменений, могут оказать специалисты «Единого портала налоговых услуг». Они готовы оплатить госпошлину за внесение изменений и проконсультировать вас по всем сопутствующим вопросам.

По любым вопросам необходимо обращаться по телефону: 8-495-134-33-40 (многоканальный)

Порядок внесения изменений

Все изменения подлежат регистрации в обязательном порядке в МИФНС 46 города Москва в срок, не превышающий трех дней.

Для этого необходимо предоставить следующие документы:

  • решение общего собрания учредителей о вносимых изменениях;
  • заявление по форме Р13001;
  • документ, который подтверждает уплату государственной пошлины;
  • перечень изменений, вносимых в учредительные документы.

При смене учредителей, дополнительно к указанному списку предоставляется:

  • нотариально удостоверенные договора купли-продажи долей.

Внесение изменений в учредительные документы

Внесение изменений в устав (учредительные документы) юридических лиц необходим в следующих случаях:

  • изменение размера уставного фонда;
  • смена наименования;
  • создание представительства;
  • смена юридического адреса;
  • изменение срока полномочий руководителя;
  • изменения, связанные с видами осуществляемой деятельности;
  • смена учредителей;

Внесение изменений в ЕГРЮЛ

(не связанные с изменениями, вносимыми в учредительные документы)

Не редки случаи, когда в ООО происходит смена генерального директора (директора). Информация о руководителе в учредительные документы не вносится, такие сведения содержаться в ЕГРЮЛ. Соответственно, необходимо осуществить государственную регистрацию таких сведений, и подать в налоговую инспекцию в срок, не превышающий трех дней, заявление о внесении изменений в ООО по форме Р14001. Заявление должно быть обязательно заверено нотариусом. Вместе с заявление потребуется представить следующие документы:

  • протокол собрания учредителей об окончании полномочий предыдущего руководителя и назначении нового;
  • приказ о назначении нового руководителя.

Внесение изменений в ЕГРИП

Сведения, содержащиеся в государственном реестре об индивидуальном предпринимателе, могут измениться. Произойти это может, в случае изменения предпринимателем таких данных как:

  • смена фамилии;
  • гражданства;
  • места жительства;
  • паспортных данных;
  • банковских счетов.

Для внесения изменений, ИП необходимо подать в налоговую инспекцию № 46 города Москва следующий перечень документов:

  • заявление по форме Р24001;
  • копия документа, являющегося подтверждением произошедших изменений.

В случае, если изменения касаются смены места жительства, то в соответствии с нормами пункта 4 статьи 84 НК РФ, документы подаются в налоговую инспекцию по старому месту регистрации. А уже ИФНС, в свою очередь, передает сведения по новому адресу регистрации.

По внесению изменений необходимо обращаться по телефону: 8-495-134-33-40 (многоканальный)

Если Вы заметили на сайте опечатку или неточность, выделите её
и нажмите на клавиатуре: Ctrl + Enter или нажмите сюда.

Обзор арбитражной практики оспаривания регистрационных записей и решений налогового органа о внесении изменений в ЕГРЮЛ

1. Внесение изменений в государственный реестр на основании документов, не соответствующих закону, может являться основанием для удовлетворения требования заинтересованного лица о признании незаконной записи о государственной регистрации изменений в сведения ЕГРЮЛ[1].

2. При отсутствии иска о незаконности записи о государственной регистрации изменений в сведения ЕГРЮЛ установление факта не проведения собрания по утверждению той редакции Устава, которая зарегистрирована налоговым органом, в силу ст. 16 АПК РФ влечет обязательность внести в ЕГРЮЛ сведения о недействительности самой записи как условие реального восстановления прав участника общества[2].

3. Государственная регистрация изменений, внесенных в устав, произведенная ИФНС может быть признана недействительной в случае признания недействительным протокола общего собрания, принятого с существенным нарушением закона, в том числе и по причине не извещения акционера[3].

4. Иск к ИФНС о признании недействительными решений о государственной регистрации изменений, вносимых в учредительные документы общества, и обязании Инспекции внести в ЕГРЮЛ записи о недействительности оспариваемых решений (в порядке обжалования ненормативных правовых актов налогового органа) подлежит удовлетворению в случае, если решение собрания, являющееся основанием для внесения изменений, признано недействительным[4].

5. Внесение в ЕГРЮЛ записей о признании судом недействительными записей ЕГРЮЛ о регистрации изменения сведений об обществе может не привести к восстановлению в реестре записи о лице как об участнике в связи с наличием в реестре иных более поздних записей, не оспоренных в судебном порядке[5].

6. Для признания решения ИФНС незаконным (в порядке обжалования ненормативных правовых актов налогового органа) суд должен установить наличие двух условий в совокупности: несоответствие оспариваемого решения закону или иному нормативному правовому акту, а также нарушение им интересов заявителя в сфере предпринимательской и иной экономической деятельности[6].

7. Запись в ЕГРЮЛ о внесении изменений может быть признана недействительной при недействительности решения общего собрания участников, недействительного по причине отсутствия на нем заблаговременно неуведомленного истца, не ознакомленного с предлагаемой редакцией устава, поскольку лишает истца возможности своевременно распорядиться правом на выход из состава участников с выплатой действительной стоимости доли, что влечет вывод о возникновении у истца убытков в связи с принятием решения[7].

8. Запись в ЕГРЮЛ может быть оспорена в порядке главы 24 АПК РФ в случае ничтожности решения собрания участников, являющимся основанием для внесения данной записи[8].

9. Иск к ИФНС о признании недействительными решений о государственной регистрации, о внесении изменений в сведения о юридическом лице и исключении из ЕГРЮЛ регистрационных записей о смене руководителя подлежит удовлетворению в случае, если первоначальный договор купли-продажи доли признан судом недействительным, а действия лиц, направленных на смену руководителя, признаны преступлением вступившим в силу приговором суда[9].

10. Внесение изменений в сведения о юридическом лице возможно лишь двумя способами: либо самостоятельно, либо путем признания недействительными в судебном порядке решения юридического лица и решения о государственной регистрации изменений[10].

11. Если оспариваемые действия регистрирующего органа совершены на основании документов, объем которых формально соответствует предъявляемым требованиям, но содержащаяся в них информация не соответствует фактическим обстоятельствам и требованиям закона, нарушают права заявителя как акционера на участие в управлении делами общества, такие действия могут быть признаны незаконными[11].

12. Исковые требования к ИФН об исключении из ЕГРЮЛ записи о внесении изменений могут обосновываться нарушением правил проведения общего собрания и правом участника на  обжалование решения[12].

13. Оспаривание реестровых записей о реорганизации является допустимым способом защиты, позволяющим разрешить существующий корпоративный спор[13].

14. Запись в ЕГРЮЛ о прекращении деятельности общества в связи с ликвидацией может быть признана недействительной в случае предоставления в ИФНС недостоверного ликвидационного баланса (с оговоркой на возможность пересмотра)[14].

15. Отсутствие в повестке дня и в принятых решениях общего собрания изменений устава, отсутствие указаний на новую редакция устава, а также не направление участнику проекта нового устава, зарегистрированного позднее ИФНС, свидетельствует об отсутствии юридической силы у принятого решения и влечет недействительность положений устава,  измененных таким решением[15].

16. По делам о признании недействительным решения общего собрания об избрании директора и признании недействительной соответствующей регистрационной записи в ЕГРЮЛ ИФНС является вторым ответчиком[16].

17. Оспаривание государственной регистрации изменений, осуществленных на основании незаконного решения, является ненадлежащим способом защиты права[17]. (-)

18. Отмена регистрационной записи в ЕГРЮЛ, принятой по решению общества о прекращении полномочий предыдущего руководителя и регистрации возникновения полномочий нового руководителя, признанному судом недействительным, при отсутствии между ними спора о руководстве не соответствует принципу достоверности содержащихся в реестре сведений, нарушает права предыдущего руководителя на размещение в реестре информации о нем как об ответственном лице общества[18].  

19. Не может считаться началом течения срока давности дата внесения изменений в ЕГРЮЛ, поскольку запись сама по себе не раскрывает существо изменений в учредительных документах[19].

ВНЕСЕНИЕ ИЗМЕНЕНИЙ В ЕГРЮЛ — Юридическая компания Эксперт, Краснодар | Юридические и бухгалтерские услуги | Налоговые консультации

1. Назначение и область действия
1.1. Настоящий документ (далее – Политика) определяет цели и общие принципы обработки персональных данных, а также реализуемые меры защиты персональных данных в организации «Эксперт». Политика является общедоступным документом Оператора и предусматривает возможность ознакомления с ней любых лиц.
1.2. Политика действует бессрочно после утверждения и до ее замены новой версией.
1.3. В Политике используются термины и определения в соответствии с их значениями, как они определены в ФЗ-152 «О персональных данных».
1.4. Политика распространяется на всех сотрудников организации «Эксперт», работников по трудовым договорам и сотрудников, работающих по договорам подряда, и все структурные подразделения организации, включая обособленные подразделения. Требования Политики также учитываются и предъявляются в отношении иных лиц при необходимости их участия в процессе обработки персональных данных Оператором, а также в случаях передачи им в установленном порядке персональных данных на основании соглашений, договоров, поручений на обработку.
2. Сведения об обработке персональных данных
2.1. Обработка персональных данных Оператором ведется смешанным способом: с использованием средств автоматизации и без.
2.2. Действия с персональными данными включают сбор, запись, систематизацию, накопление, хранение, уточнение (обновление, изменение), извлечение, использование, передача (распространение, предоставление, доступ), обезличивание, блокирование, удаление, уничтожение персональных данных.
2.3. Обработка персональных данных осуществляется Оператором на законной и справедливой основе, правовыми основания для обработки являются:

  • — Конституция Российской Федерации;
  • — Трудовой кодекс Российской Федерации;
  • — Гражданский кодекс Российской Федерации;
  • — Налоговый кодекс Российской Федерации;
  • — Федеральный закон от 27.07.2006г. № 152-ФЗ «О персональных данных»;
  • — Федеральный закон от 10.01.2002г. № 1-ФЗ «Об электронной цифровой подписи»;
  • — Федеральный закон от 06.04.2011г. № 63-ФЗ «Об электронной подписи»;
  • — Федеральный закон от 04.05.2011г. № 99-ФЗ «О лицензировании отдельных видов деятельности»;
  • — Федеральный закон от 07.07.2003г. № 126-ФЗ «О связи»;
  • — Федеральный закон от 01.04.1996г. № 27-ФЗ «Об индивидуальном (персонифицированном) учете в системе обязательного пенсионного страхования»;
  • — Федеральный закон от 24.07.2009г. № 212-ФЗ «О страховых взносах в Пенсионный Фонд РФ, Фонд социального страхования РФ, Федеральный Фонд обязательного медицинского страхования и территориальные фонды обязательного медицинского страхования»;
  • — Федеральный закон от 22.10.2004г. № 125-ФЗ «Об архивном деле в РФ»;
  • — Закон РФ от 10.07.1992г. № 3266-1 «Об образовании».

2.4. Содержание и объем обрабатываемых персональных определяются исходя из целей обработки. Не обрабатываются персональные данные, избыточные или несовместимые по отношению к следующим основным целям:

  • — заключение трудовых отношений с физическими лицами;
  • — выполнение договорных обязательств Оператора;
  • — соблюдение действующего трудового, бухгалтерского, пенсионного, иного законодательства Российской Федерации.

2.5. К основным категориям субъектов персональных данных, чьи данные обрабатываются Оператором, относятся:
физические лица, состоящие в трудовых и гражданско-правовых отношениях с Оператором;
физические лица, состоящие в трудовых и гражданско-правовых отношениях с контрагентами Оператора;
кандидаты на замещение вакантных должностей.
2.6. Для указанных категорий субъектов могут обрабатываться: фамилия, имя, отчество; год, месяц, дата рождения; место рождения,
2.6. Для указанных категорий субъектов могут обрабатываться: фамилия, имя, отчество; год, месяц, дата рождения; место рождения, адрес; семейное положение; социальное положение; имущественное положение; образование; профессия; доходы; ИНН, СНИЛС, контактная информация (телефон, адрес электронной почты), иные сведения, предусмотренные типовыми формами и установленным порядком обработки.
2.7. При обработке обеспечиваются точность персональных данных, их достаточность и актуальность по отношению к целям обработки персональных данных. При обнаружении неточных или неполных персональных данных производится их уточнение и актуализация.
2.8. Для персональных данных, не являющихся общедоступными, обеспечивается конфиденциальность.
2.9. Обработка и хранение персональных данных осуществляются не дольше, чем этого требуют цели обработки персональных данных, если отсутствуют законные основания для дальнейшей обработки, например, если федеральным законом или договором с субъектом персональных данных не установлен соответствующий срок хранения. Обрабатываемые персональные данные подлежат уничтожению либо обезличиванию при наступлении следующий условий:

  • — достижение целей обработки персональных данных или максимальных сроков хранения — в течение 30 дней;
  • — утрата необходимости в достижении целей обработки персональных данных — в течение 30 дней;
  • — предоставление субъектом персональных данных или его законным представителем подтверждения того, что персональные данные являются незаконно полученными или не являются необходимыми для заявленной цели обработки — в течение 7 дней;
  • — невозможность обеспечения правомерности обработки персональных данных — в течение 10 дней;
  • — отзыв субъектом персональных данных согласия на обработку персональных данных, если сохранение персональных данных более не требуется для целей обработки персональных данных — в течение 30 дней;
  • — отзыв субъектом персональных данных согласия на использование персональных данных для контактов с потенциальными потребителями при продвижении товаров и услуг — в течение 2 дней;
  • — истечение сроков исковой давности для правоотношений, в рамках которых осуществляется либо осуществлялась обработка персональных данных;
  • — ликвидация (реорганизация) Оператора.

2.10. Обработка персональных данных на основании договоров и иных соглашений Оператора, поручений Оператору и поручений Оператора на обработку персональных данных осуществляется в соответствии с условиями этих договоров, соглашений Оператора, а также соглашений с лицами, которым поручена обработка или которые поручили обработку на законных основаниях. Такие соглашения могут определять, в частности:

  • — цели, условия, сроки обработки персональных данных;
  • — обязательства сторон, в том числе меры по обеспечению конфиденциальности;
  • — права, обязанности и ответственность сторон, касающиеся обработки персональных данных.

2.11. В случаях, не предусмотренных явно действующим законодательством или договором, обработка осуществляется после получения согласия субъекта персональных данных. Согласие может быть выражено в форме совершения действий, принятия условий договора-оферты, проставления соответствующих отметок, заполнения полей в формах, бланках, или оформлено в письменной форме в соответствии с законодательством. Обязательным случаем получения предварительного согласия является, например, контакт с потенциальным потребителем при продвижении товаров и услуг Оператора на рынке.

3. Меры по обеспечению безопасности персональных данных
3.1. Оператор предпринимает необходимые правовые, организационные и технические меры для обеспечения безопасности персональных данных для их защиты от несанкционированного (в том числе, случайного) доступа, уничтожения, изменения, блокирования доступа и других несанкционированных действий. К таким мерам, в частности, относятся:

  • — назначение сотрудников, ответственных за организацию обработки и обеспечение безопасности персональных данных;
  • — проверка наличия в договорах и включение при необходимости в договоры пунктов об обеспечении конфиденциальности персональных данных;
  • — издание локальных актов по вопросам обработки персональных данных, ознакомление с ними работников, обучение пользователей;
  • — обеспечение физической безопасности помещений и средств обработки, пропускной режим, охрана, видеонаблюдение;
  • — ограничение и разграничение доступа сотрудников и иных лиц к персональным данным и средствам обработки, мониторинг действий с персональными данными;
  • — определение угроз безопасности персональных данных при их обработке, формирование на их основе моделей угроз;
  • — применение средств обеспечения безопасности (антивирусных средств, межсетевых экранов, средств защиты от несанкционированного доступа, средств криптографической защиты информации), в том числе прошедших процедуру оценки соответствия в установленном порядке;
  • — учёт и хранение носителей информации, исключающее их хищение, подмену, несанкционированное копирование и уничтожение;
  • — резервное копирование информации для возможности восстановления;
  • — осуществление внутреннего контроля за соблюдением установленного порядка, проверка эффективности принятых мер, реагирование на инциденты.

4. Права субъектов персональных данных
4.1. Субъект персональных данных имеет право отозвать согласие на обработку персональных данных, направив соответствующий запрос Оператору по почте или обратившись лично.
4.2. Субъект персональных данных имеет право на получение информации, касающейся обработки его персональных данных, в том числе содержащей:

  • — подтверждение факта обработки персональных данных Оператором;
  • — правовые основания и цели обработки персональных данных;
  • — цели и применяемые Оператором способы обработки персональных данных;
  • — наименование и место нахождения Оператора, сведения о лицах (за исключением сотрудников/работников Оператора), которые имеют доступ к персональным данным или которым могут быть раскрыты персональные данные на основании договора с Оператором или на основании федерального закона;
  • — обрабатываемые персональные данные, относящиеся к соответствующему субъекту персональных данных, источник их
  • — получения, если иной порядок представления таких данных не предусмотрен федеральным законом;
  • — сроки обработки персональных данных, в том числе сроки их хранения;
  • — порядок осуществления субъектом персональных данных прав, предусмотренных Федеральным законом «О персональных данных»;
  • — информацию об осуществленной или о предполагаемой трансграничной передаче данных;
  • — наименование или фамилию, имя, отчество и адрес лица, осуществляющего обработку персональных данных по поручению Оператора, если обработка поручена или будет поручена такому лицу;
  • — иные сведения, предусмотренные Федеральным законом «О персональных данных» или другими федеральными законами.

4.3. Субъект персональных данных вправе требовать от Оператора уточнения его персональных данных, их блокирования или уничтожения в случае, если персональные данные являются неполными, устаревшими, неточными, незаконно полученными или не являются необходимыми для заявленной цели обработки, а также принимать предусмотренные законом меры по защите своих прав.
4.4. Если субъект персональных данных считает, что Оператор осуществляет обработку его персональных данных с нарушением требований Федерального закона «О персональных данных» или иным образом нарушает его права и свободы, субъект персональных данных вправе обжаловать действия или бездействие Оператора в уполномоченный орган по защите прав субъектов персональных данных (Федеральная служба по надзору в сфере связи, информационных технологий и массовых коммуникаций — Роскомнадзор) или в судебном порядке.
4.5. Субъект персональных данных имеет право на защиту своих прав и законных интересов, в том числе на возмещение убытков и (или) компенсацию морального вреда в судебном порядке.
5. Роли и ответственность
5.1. Права и обязанности Оператора определяются действующим законодательством и соглашениями Оператора.
5.2. Контроль исполнения требований настоящей Политики осуществляется ответственным за организацию обработки персональных данных и Отделом информационной безопасности Оператора в пределах их полномочий.
5.3. Ответственность лиц, участвующих в обработке персональных данных на основании поручений Оператора, за неправомерное использование персональных данных устанавливается в соответствии с условиями заключенного между Оператором и контрагентом гражданско-правового договора или Соглашения о конфиденциальности информации.
5.4. Лица, виновные в нарушении норм, регулирующих обработку и защиту персональных данных, несут материальную,
дисциплинарную, административную, гражданско-правовую или уголовную ответственность в порядке, установленном федеральными законами, локальными актами, соглашениями Оператора.
5.5. Политика разрабатывается ответственным за организацию обработки персональных данных и вводится в действие после утверждения руководителем Оператора. Предложения и замечания для внесения изменений в Политику следует направлять по адресу http://expert-kuban.ru. Политика пересматривается ежегодно для поддержания в актуальном состоянии и актуализируется по мере необходимости.

Инструкция по внесению изменений в ООО

Шаг 1. Провести внеочередное собрание участников и принять решение

Большинство изменения в компании одобряются общим собранием участников. По результатам проведения такого собрания готовится протокол, в котором отражены основные положения по изменениям. Если в компании единственный участник, то он принимает решение и готовит его в документе Решение единственного участника.

Шаг 2. Подготовить документы для предоставления в налоговую инспекцию

Обратите внимание, что формы Р13001 и Р14001 с 25 ноября 2020 года больше не применяются. Новая форма Р13014 утверждена Приказом ФНС России от 31.08.2020 N ЕД-7-14/[email protected]

К протоколу или решению нужно добавить форму Р13014 для уведомления налоговой инспекции об изменениях. Если меняются и другие учредительные документы, то их также необходимо приложить к списку подаваемых документов.

Шаг 3. Удостоверить у нотариуса подпись на заявлении о внесении изменений

Заявитель приносит нотариусу учредительные документы предприятия и документы, которые будут подаваться в налоговую инспекцию, и представляет их нотариусу. Нотариус удостоверяет подпись заявителя на форме Р13014.

Если документы отправляются электронно с помощью ЭЦП, удостоверять подпись у нотариуса не требуется.

Шаг 4. Подать документы в налоговую инспекцию

По общему правилу документы должны быть поданы в течение семи рабочих дней с момента внесения изменений в ООО (исключение для увеличения УК, распределения доли, смены местанахождения). Налоговый инспектор обязан выдать расписку о получении документов, в которой будут перечислены все документы, поданные заявителем в ИФНС.

Шаг 5. Получить лист записи

В течение пяти рабочих дней налоговая должна зарегистрировать изменения.

В назначенный день заявитель или его доверенное лицо приходят в налоговую и получают лист записи о регистрации изменений.

Шаг 6. Уведомить все заинтересованные стороны

После регистрации изменений в налоговой инспекции, следует уведомить всех контрагентов об этих изменениях. Особенно это касается смены адреса компании, и смены генерального директора.

Исправление ошибок в ЕГРЮЛ, выгодные цены

Исправление ошибок в ЕГРЮЛ – процесс, связанный с корректировкой данных, ошибочно занесенных в Единый реестр. При этом виновниками погрешностей в информации о юридическом лице могут быть как заявители, так и инспекторы налоговой службы.

Федерального закона, регламентирующего действия заявителя при обнаружении ошибок в выписке не существует. Поэтому опечатки, грамматику и цифровые комбинации владелец компании должен внимательно проверить самостоятельно сразу же при получении пакета документов в ИФНС.

Если же вы невнимательно прочитали выписку, а ошибка в выписке имеет место быть, «Столичный центр помощи бизнесу» поможет вам быстро и эффективно внести изменения в Единый государственный реестр юридических лиц. Наши специалисты, имея многолетнюю практику в экономических и правовых вопросах, в минимальные сроки подготовят необходимый пакет документации для корректировки данных о вашей компании в реестре юридических лиц, а также предложат вам оптимальный вариант исправления неточностей в данных.

Так на сегодняшний день исправление ошибок в ЕГРЮЛ возможно тремя способами:

обращением в окно выдачи документации в день получения выписки,

подачей заявления по форме Р14001 в регистрирующий орган,

направлением письма с описанием ошибок в канцелярию регистрирующего органа.

В первом случае процесс корректировки данных займет 2 рабочих дня, во втором — в среднем 5-8 рабочих дней, в третьем — не менее месяца.

Ошибки, допущенные заявителем

Заполняя документы, заявитель может допустить несколько неточностей, присутствие которых в выписке ЕГРЮЛ в дальнейшем может привести к проблемам в функционировании компании. Так к наиболее распространенным опечаткам и опискам сегодня принято относить:

опечатки в русскоязычных и англоязычных названиях компаний,

опечатки при внесении адреса организации,

появление «лишних» участников Общества или же «исчезновение» его членов,

ошибки, возникающие при внесении паспортных данных участников Общества и директора,

ошибочно записанное значение Уставного капитала,

неверное значение суммы распределенных долей Уставного капитала участников, сумма которых не соответствует общему размеру.

Решить возникшую проблему руководство компании может, подав в ИФНС документы, аналогичные пакету для внесения изменений в ЕГРЮЛ. По результатам проверки налоговая предоставит новую выписку с внесенными в нее изменениями.

Ошибки по вине налогового инспектора

Сотрудники налоговой службы, отвечающие за внесение данных о регистрируемых компаниях в ЕГРЮЛ, иногда заносят информацию об организациях и их участниках с ошибками: это могут быть опечатки, описки, погрешности грамматического характера, неверные сокращения и аббревиатуры. Однако как таковой ответственности за свою оплошность инспекторы не несут.

Единственный аргумент, который может выступать в вашу пользу в спорном вопросе, – это приоритет бумажного носителя перед электронным, регламентированный Федеральным законом №129-ФЗ от 08.08.2001 года. Фактически это обозначает, что при сверке вашего заявления и данных, занесенные в электронную базу инспектором, информация в форме Р14001 будет считаться заведомо верной.

Однако признание ошибки сотрудника налоговой вряд ли будет для вас полезным, если вы обнаружили неточность не в день получения выписки в ИФНС.

Какие документы необходимо подать

Рассмотрим три варианты действий при обнаружении ошибок в выписке из ЕГРЮЛ.

1. Обнаружение ошибки в день получения выписки:

Если получив документы в ИФНС, вы обнаружили неточности в данных, исправить их необходимо немедленно. Это самый быстрый и безболезненный вариант.

Обратившись к начальнику отдела, вы заполняете:


протокол разногласий.

Переработка данных, еще не поступивших в архив ЕГРЮЛ, займет не более 2 рабочих дней, а вы получите новую выписку с внесенными в нее исправлениями.

2. Обнаружение ошибки по вине заявителя:

Если вы обнаружили собственную ошибку в выписке спустя некоторое время после получения документов, вам необходимо подать в регистрирующий орган:

форму Р14001, заверенную нотариально (в форме прописывает ГРН, в котором была допущена ошибка),

форму, в которой была допущена ошибка с исправленными маркером верными данными,

сопроводительное письмо с подробным описанием неточностей в информации о компании.

Дополнительно для оформления данного пакета документов вам могут понадобиться:

Копии учредительных документов и изменений к ним,

Копия свидетельства о внесении в ЕГРЮЛ,

Паспортные данные и приказы о назначении руководителя и главного бухгалтера,

Паспортные данные учредителей,

Выписка из ЕГРЮЛ (срок достоверности – 1 месяц).

Рассматривает заявление ИФНС в течение 7 рабочих дней. А по итогу вы получаете новую выписку с внесенными в нее исправлениями.

Процедура не требует оплаты госпошлины и по своей сути является полным аналогом мероприятия по внесению изменений в ЕГРЮЛ.

3. Обнаружение ошибки по вине регистратора:

Если вы нашли ошибку в выписке, допущенную инспектором налоговой службы, для ее исправления вам достаточно написать заявление в произвольной форме, направив его в канцелярию ИФНС.

Ваша бумага будет рассмотрена в течение 1 месяца, после чего вы либо получите новую выписку с внесенными исправлениями почтой на юридический адрес вашей организации, либо отказ ИФНС по причине не признания регистратором их ошибки.

В любом случае данный вариант является самым неудобным и длительным. Поэтому, даже если ошибку допустил инспектор, намного проще признать ее собственной и внести исправления в ЕГРЮЛ за 7 рабочих дней.

OCC завершает разработку правила, требующего от крупных банков предоставлять справедливый доступ к банковским услугам, капиталу и кредитам

Выпуск новостей 2021-8 | 14 января 2021 г.

Поделиться этой страницей:

ВАШИНГТОН — Управление валютного контролера (OCC) сегодня опубликовало свое окончательное правило для обеспечения справедливого доступа к банковским услугам, предоставляемым крупными национальными банками, федеральными сберегательными ассоциациями, а также федеральными филиалами и агентствами иностранных банковских организаций.

Правило кодифицирует более чем десятилетнее руководство OCC, в котором говорится, что банки должны проводить оценку рисков отдельных клиентов, а не принимать широкие решения, затрагивающие целые категории или классы клиентов, при предоставлении доступа к услугам, капиталу и кредитам.

«Когда крупный банк решает закрыть доступ к благотворительным организациям или даже посольствам, обслуживающим опасные части мира, или компаниям, ведущим в США законный бизнес, поддерживающим местные рабочие места и национальную экономику, им необходимо продемонстрировать свою работу и законный бизнес. причины для этого «, — сказал исполняющий обязанности финансового контролера Брайан П.Брукс. «Как поясняли в выступлениях, инструкциях и свидетельских показаниях контролеры и сотрудники предыдущих администраций, банки не должны прекращать обслуживание целых категорий клиентов без проведения индивидуальной оценки рисков. на необоснованных или категоричных заявлениях о риске без фактического анализа. Более того, выборные должностные лица должны определять, что является законным, а что незаконным в нашей стране ».

Правило реализует формулировку, включенную в Раздел III Закона Додда – Фрэнка о реформе Уолл-Стрит и защите потребителей 2010 года, в котором OCC было поручено «обеспечивать безопасность, надежность и соблюдение законов и нормативных актов, справедливый доступ к финансовым услугам, и справедливое отношение к клиентам со стороны учреждений и других лиц, находящихся под его юрисдикцией.«Устав расширил миссию OCC, включив в нее справедливый доступ отдельно от справедливого отношения после последнего финансового кризиса, во время которого правительство предоставило значительные государственные ресурсы для поддержки банковской системы.

Правило применяется к крупнейшим банкам с активами более 100 миллиардов долларов, которые могут оказывать существенное влияние на ценообразование или влияние на секторы национальной экономики. Согласно правилу, банки по-прежнему определяют свои продуктовые линейки и географические рынки и могут принимать законные бизнес-решения о том, что и кому обслуживать.Правило требует, чтобы покрытые банки делали те продукты и услуги, которые они решили предлагать, доступными для всех клиентов в сообществах, которые они обслуживают, на основе рассмотрения количественных, беспристрастных, основанных на оценке рисков стандартов, установленных банком. В соответствии с правилом решение застрахованного банка об отказе в предоставлении услуг на основании такой объективной оценки не нарушает обязательства банка по обеспечению справедливого доступа. Однако решение застрахованного банка не предлагать определенный вид финансового продукта или услуги или не участвовать в конкуренции на географическом рынке остается неизменным.

При окончательной доработке правила агентство рассмотрело более 35 000 комментариев и предложений заинтересованных сторон. В результате, окончательное правило исключает раздел 55.1 (b) (3) предложенного правила, которое требовало бы, чтобы покрытый банк не отказывал любому лицу в предоставлении финансовых услуг, предлагаемых банком, когда эффект отказа заключается в предотвращении, ограничении , или иным образом ставить человека в невыгодное положение: (1) от входа на рынок или в бизнес-сегмент или конкуренции на нем; или (2) таким образом, чтобы приносить пользу другому лицу или бизнесу, в котором застрахованный банк имеет финансовый интерес.Агентство определило, что это требование привело бы к нормативному бремени, не способствуя достижению основной цели правила. На основе этого анализа агентство отменило это требование, чтобы сфокусировать правило на справедливости процессов принятия решений покрываемыми банками и принципах разумного управления рисками, а также для облегчения применения этого правила OCC. Остальная часть правила по существу не изменилась по сравнению с предложением.

Правило вступает в силу 1 апреля 2021 года.

Ссылка по теме

Контактная информация для СМИ

Брайан Хаббард
(202) 649-6870

OCC приостанавливает действие правила банка, которое разозлило Уолл-стрит и инвесторов, занимающихся проблемами климата

Прохожий передает печать Управления финансового контролера (OCC), вывешенную за пределами штаб-квартиры организации в Вашингтоне, округ Колумбия, США, в среду, 20 марта 2019 г.

Эндрю Харрер | Bloomberg | Getty Images

Управление валютного контролера объявило, что приостановило публикацию своего правила справедливого доступа к финансовым услугам, что, по его словам, позволит следующему подтвержденному контроллеру денежного обращения пересмотреть окончательное правило, а общественность прокомментирует его. OCC получено.

Согласно этому правилу, крупнейшие банки будут подвергаться тщательной проверке, когда они отказывают в обслуживании любому клиенту на основании факторов риска, которые невозможно измерить количественно, например, с некоторыми экологическими, социальными и корпоративными рисками, а также репутационными рисками.

Критики, от банковских торговых групп до инвесторов ESG и ученых-юристов, во время доработки правила ранее в этом месяце заявили, что оно было поспешным, плохо аргументированным, плохо написанным и может стать предметом юридических проблем и проблем со стороны Конгресса.

Примерно 35 000 комментариев общественности в ответ на правило поступили к крайнему сроку 4 января. Правило было предложено в ноябре, и срок до крайнего срока комментариев был намного короче стандартного — от 60 до 90 дней. Регулирующий орган, который должен просмотреть все общественные комментарии перед окончательной доработкой правил, опубликовал их через восемь рабочих дней после указанного срока.

«Давние надзорные указания OCC о том, что банки должны избегать увольнения широких категорий клиентов без оценки индивидуального риска, остаются в силе», — говорится в заявлении OCC в четверг.«Решение приостановить публикацию правила было независимым решением OCC».

Некоторые консервативные аналитические центры и сегменты отраслей, которые чувствуют угрозу из-за проблем, из-за которых банки все чаще отказывают в предоставлении услуг, включая кредитование, — например, в энергетике, производстве оружия и сельском хозяйстве — поддержали правило. Критики назвали это «правилом оружейников и нефтяников», хотя голоса, выражающие поддержку, были более распространены, включая, например, сельскохозяйственные интересы, обеспокоенные тем, что активисты по защите прав животных могут атаковать банки, которые предоставляют им ссуды.Криптовалютные проекты, марихуановый бизнес, секс-работники и другие ниши также почувствовали угрозу и нашли поддержку со стороны таких групп, как Electronic Frontier Foundation, которые назвали цель правила как прекращение «финансовой цензуры».

Представитель OCC ранее сообщил CNBC, что многие критики ошибочно принимают правило, запрещающее банкам прекращать обслуживание и предоставлять кредиты для рискованного бизнеса. «Это неправильно. Предложение требует от крупных банков демонстрации своей работы и проведения объективной оценки рисков отдельных клиентов в отношении предоставления услуг в соответствии с предыдущими инструкциями, выпущенными Управлением финансового контролера.«

Правило применяется к крупнейшим банкам с активами более 100 миллиардов долларов, которые« могут оказывать существенное влияние на ценообразование или влияние на секторы национальной экономики ».

Правило требует, чтобы покрытые банки делали продукты и услуги доступными для всех клиентов. в сообществах, которые они обслуживают, на основе рассмотрения количественных, беспристрастных, основанных на оценке рисков стандартов, установленных банком

Противодействие со стороны торговых групп банков было последовательным с момента первого предложения правила и после его окончательной доработки.

«Мы разочарованы, что исполняющий обязанности финансового контролера решил ускорить окончательное утверждение этого поспешно продуманного и плохо составленного правила в последний день своего пребывания в должности. Правилу недостает ни логики, ни юридической основы, оно игнорирует основные факты о том, как работает банковское дело, и это подорвет безопасность и устойчивость банков, к которым он применяется », — сказал президент и главный исполнительный директор Bank Policy Institute Грег Баер, представляющий крупнейшие банки, в заявлении ранее в этом месяце. << Его существенные проблемы перевешивают только вопиющие процедурные недостатки процесса нормотворчества, и по этим причинам он вряд ли выдержит проверку."

Американская ассоциация банкиров, которая представляет более широкую банковскую отрасль, была обеспокоена риском применения более широкой интерпретации ко всем банкам и назвала правило» произвольным и капризным «в своем комментарии в OCC, поданном в прошлом месяце, и заявил, что ему не хватает «четких законодательных полномочий, его непоследовательности и потенциального конфликта с давней и широко принятой практикой управления рисками и надзора».

Инвесторы ESG были столь же суровы.

«Это правило гласит, что банки не должны заниматься оценкой рисков .Это то, что банки делают каждый день, — сказал Стив Ротштейн, глава Ceres Accelerator for Sustainable Capital Markets, группы по защите инвестиций в устойчивое развитие. взаимодействие с ESG, — сказал он CNBC ранее в этом месяце. — Нельзя просто сказать, что это не та сфера деятельности, в которой вы хотите заниматься. Это возмутительная последняя попытка отказа. Более широкий вопрос о том, как мы измеряем риск, количественно оцениваем климатический риск, является важным, но это конкретное правило отвлекает.»

Наш ответ на пандемию коронавируса

Поощрение банков к работе с затронутыми клиентами и сообществами

Всего через несколько дней после того, как Всемирная организация здравоохранения официально объявила о глобальной пандемии, мы выпустили заявление, в котором признали, что эта уникальная и развивающаяся ситуация может вызвать значительные временные сбои в работе и создать проблемы, и побудили финансовые учреждения работать с клиентами и сообществами, затронутыми COVID-19. В частности, мы заявили, что осмотрительные усилия учреждения по изменению условий существующих займов для затронутых клиентов не будут подвергаться критике со стороны проверяющих.Мы обязались работать с затронутыми финансовыми учреждениями, чтобы снизить нагрузку при планировании проверок, в том числе более широко использовать сторонние проверки в соответствии с применимыми правовыми и нормативными требованиями.

Повышение гибкости банков для удовлетворения потребностей своих клиентов

Мы рекомендовали банкам работать со всеми заемщиками, особенно с теми из секторов промышленности, которые особенно уязвимы к экономической нестабильности. Мы пояснили, что осмотрительные усилия по изменению условий существующих кредитов для затронутых клиентов не будут подвергаться критике со стороны проверяющих, и что определенные изменения в кредитах, внесенные в ответ на COVID-19, не являются реструктуризацией проблемной задолженности (TDR).Мы также обеспечили гибкость, чтобы позволить ипотечным обслуживающим организациям работать с нуждающимися потребителями и позволить отсроченное получение необходимых оценок для определенных ссуд на жилую и коммерческую недвижимость.

  • Часто задаваемые вопросы: Часто задаваемые вопросы: для финансовых учреждений, пострадавших от коронавирусной болезни 2019 г. (обновлено в мае 2021 г.)
  • Часто задаваемые вопросы: Закон о реинвестициях в сообщества: межведомственные часто задаваемые вопросы, связанные с пандемией COVID-19 (обновлено в марте 2021 г.)
  • Часто задаваемые вопросы: Для клиентов банков, пострадавших от коронавирусной болезни 2019 г. (Обновлено в январе 2021 г.)
  • Пресс-релиз: Федеральные банковские агентства поощряют банки использовать дисконтное окно Федеральной резервной системы (16 марта 2020 г.)
  • Совместная версия FFIEC: Заявление об использовании буферов капитала и ликвидности (17 марта 2020 г.)
  • Вопросы и ответы: Вопросы и ответы по заявлению относительно использования буферов капитала и ликвидности (17 марта 2020 г.)
  • Промежуточное окончательное правило: Соответствующий нераспределенный доход (17 марта 2020 г.)
  • Пресс-релиз: Регулирующие органы Федерального банка издают временное окончательное правило для механизма обеспечения ликвидности на денежном рынке (19 марта 2020 г.)
  • Письмо финансовому учреждению (FIL-22-2020): Межведомственное заявление об изменении ссуды финансовыми учреждениями, работающими с клиентами, пострадавшими от коронавируса (22 марта 2020 г.)
  • Письмо финансовому учреждению (FIL-28-2020): FDIC объявляет 30-дневный льготный период для отчета о вызовах за первый квартал 2020 г. (26 марта 2020 г.)
  • Письмо финансовому учреждению (FIL-30-2020): Заявление о годовых отчетах по Части 363 в ответ на коронавирус (27 марта 2020 г.)
  • Уведомление: Стандартизированный подход к расчету суммы риска по производным контрактам, 85 Fed.Рег. 17721 (27 марта 2020 г.)
  • Письмо финансового учреждения (FIL-32-2020): Совместное заявление о взаимодействии пересмотренного временного окончательного правила переходного периода CECL с разделом 4014 Закона о помощи, чрезвычайной помощи и экономической безопасности в связи с коронавирусом (31 марта 2020 г.)
  • Правило регулятивного капитала: Пересмотренный переход на методологию текущих ожидаемых кредитных убытков для резервов, 85 Фед. Рег. 17723 (31 марта 2020 г.)
  • Пресс-релиз: Совместное сообщение / Федеральные агентства поощряют ипотечных организаций работать с нуждающимися домовладельцами, пострадавшими от COVID-19 (3 ​​апреля 2020 г.)
  • Пресс-релиз: совместный релиз / агентства выпускают пересмотренное межведомственное заявление об изменениях в ссуде финансовыми учреждениями, работающими с клиентами, пострадавшими от коронавируса (7 апреля 2020 г.)
  • Пресс-релиз: Совместное сообщение / Федеральные банковские агентства отложат оценку и оценку сделок с недвижимостью, затронутых COVID-19 (14 апреля 2020 г.)
  • Промежуточное окончательное правило: Real Estate Appraisals, 85 Fed.Рег. 21312 (17 апреля 2020 г.)
  • Промежуточное окончательное правило: Временные изменения в структуре коэффициента кредитного плеча местных банков, 85 ФРС. Рег. 22924 (23 апреля 2020 г.)
  • Промежуточное окончательное правило: Переход к системе коэффициента кредитного плеча местных банков, 85 ФРС. Рег. 22930 (23 апреля 2020 г.)
  • Речь: Заявление председателя FDIC Джелены МакВильямс о временном окончательном правиле: временное исключение U.S. Казначейские ценные бумаги и депозиты в Федеральных резервных банках из коэффициента дополнительного левериджа для депозитных учреждений (15 мая 2020 г.)
  • Пресс-релиз: Регулирующие органы временно изменяют коэффициент дополнительного левериджа для повышения способности банковских организаций поддерживать кредитование домашних хозяйств и предприятий в свете реакции на коронавирус (15 мая 2020 г.)
  • Письмо финансовому учреждению (FIL-82-2020): Изменения в структуре коэффициента кредитного плеча банка сообщества (26 августа 2020 г.)
  • Выступление: Председатель FDIC Елена МакВильямс перед вебинаром Школы права Чикагского университета и Американской финансовой биржи на тему «Роль миноритарных депозитных учреждений и инноваций в эпоху COVID-19» (26 августа 2020 г.)
  • Пресс-релиз: FDIC утверждает временное окончательное правило предоставления временного освобождения от требований к аудиту и отчетности согласно Части 363 (20 октября 2020 г.)
  • Заявление: Председатель FDIC Джелена МакВильямс о временном окончательном правиле о применимости требований к ежегодному независимому аудиту и отчетности за финансовые годы, заканчивающиеся в 2021 году (20 октября 2020 г.)
  • Пресс-релиз: совместный выпуск / агентства предоставляют временную помощь общественным банковским организациям (20 ноября 2020 г.)
  • Заявление: Председатель FDIC Джелена МакВильямс о временном окончательном правиле временного изменения пороговых значений активов для применения определенных правил (20 ноября 2020 г.)
Содействие кредитованию малого бизнеса

Национальные общественные банки сыграли огромную роль в государственных программах стимулирования, связанных с пандемией, таких как Программа защиты зарплаты или ГЧП.По состоянию на второй квартал 2020 года на долю местных банков приходился примерно 31 процент всех кредитов ГЧП. Мы поддержали участие банков в ГЧП, разъяснив, что кредиты, выданные в рамках ГЧП, будут иметь нулевой весовой коэффициент риска для целей капитала, основанного на риске, и утвердив правило для смягчения воздействия кредитования ГЧП на оценки банков.

  • Веб-страница: Коронавирус (COVID-19) Информация для кредиторов малого бизнеса
  • Письмо финансовому учреждению (FIL-33-2020): Пересмотрено: Новые программы SBA и Казначейства для помощи малому бизнесу (2 апреля 2020 г.)
  • Часто задаваемые вопросы: Программа защиты зарплат Администрации малого бизнеса (2 марта 2021 г.)
  • Промежуточное окончательное правило: Кредитная программа по программе защиты зарплаты и кредиты по программе защиты зарплаты, 85 Fed.Рег. 20387 (13 апреля 2020 г.)
  • Веб-семинар для банкиров: Как стать кредитором в рамках Программы защиты зарплаты (ГЧП) (23 апреля 2020 г.)
  • Пресс-релиз: совместный релиз / Регулирующие органы Федерального банка изменяют коэффициент покрытия ликвидности для банков, участвующих в механизме обеспечения ликвидности взаимных фондов денежного рынка и программе защиты зарплат (5 мая 2020 г.)
  • Промежуточное окончательное правило: Коэффициент покрытия ликвидности: обработка некоторых аварийных объектов, 85 Fed.Рег. 26835 (6 мая 2020 г.)
  • Пресс-релиз: FDIC издает окончательное правило по смягчению последствий оценки страхования вкладов от участия в Программе защиты зарплаты (ГЧП), в механизме ликвидности ГЧП и в механизме ликвидности паевых инвестиционных фондов денежного рынка (22 июня 2020 г.)
  • Заявление: Председатель FDIC Джелена МакВильямс об окончательном правиле по смягчению воздействия кредитования в рамках ГЧП на премии по страхованию вкладов (22 июня 2020 г.)
  • Круглый стол банкиров: FDIC AEI проводит круглый стол банкиров по возможностям инвестиционного фонда малого бизнеса COVID-19 в Лос-Анджелесе, Калифорния (10 сентября 2020 г.)
  • Подкаст FDIC: Эпизод 6 — Общественные банки и программа защиты зарплаты (19 ноября 2020 г.)
Защита потребителей и расширение финансовых возможностей

У нас есть множество ресурсов, которые предлагают потребителям полезную информацию, касающуюся банковского дела и COVID-19.Мы также предупреждали потребителей о мошенничестве с участием самозванцев, которые выдавали себя за представителей агентства для совершения мошеннических схем. И вместе с нашими коллегами из федерального регулятора мы поощряем банки, сберегательные ассоциации и кредитные союзы удовлетворять потребности потребителей, предлагая ответственные ссуды в небольшие доллары для нужд потребителей и малого бизнеса.

  • Пресс-релиз: FDIC объявляет о шагах по защите банков и потребителей и продолжению операций (16 марта 2020 г.)
  • Пресс-релиз: FDIC: Застрахованные банковские вклады в безопасности; Остерегайтесь потенциальных мошенников с использованием названия агентства (18 марта 2020 г.)
  • Выступление: Председатель FDIC Елена МакВильямс перед Советом по надзору за финансовой стабильностью (26 марта 2020 г.)
  • Пресс-релиз: совместный релиз / Федеральные агентства поощряют банки, сберегательные ассоциации и кредитные союзы предлагать ответственные мелкие ссуды потребителям и малому бизнесу, пострадавшим от COVID-19 (26 марта 2020 г.)
  • Письмо финансовому учреждению (FIL-26-2020): Заявление о поощрении ответственного кредитования в малых долларах потребителей и малых предприятий в ответ на COVID-19 (26 марта 2020 г.)
  • Новости потребителей Статья: COVID-19 и ваше финансовое здоровье (март 2020 г.)
  • Веб-семинар для потребителей: Ваши деньги в безопасности в финансовом учреждении с федеральным страхованием (16 апреля 2020 г.)
  • Пресс-релиз: Совместная публикация / Принципы распределения акций федеральных агентств для предложения ответственных займов в малый доллар (20 мая 2020 г.)
  • Веб-семинар: FDIC и IRS проводят общенациональный веб-семинар для обсуждения экономических последствий платежей и содействия доступу к доступным банковским счетам (24 сентября 2020 г.)
  • Вебинар: FDIC проводит вебинар по финансовой стабильности и безопасности для коренных американцев во время COVID-19 и за его пределами в Южной Дакоте и Канзасе (29 октября 2020 г.)
  • Новости потребителей Статья: COVID-19 год спустя (март 2021 г.)
Активный мониторинг финансовой системы

Мы переместили всю деятельность по надзору за пределы офиса, чтобы защитить здоровье и безопасность наших сотрудников, а также предоставить учреждениям гибкость при реагировании на операционные проблемы, вызванные пандемией.Тем не менее, мы поддерживаем наши программы надзора как в области безопасности, надежности и защиты потребителей, так и в соответствии со всеми соответствующими законодательными требованиями и внутренними целями. Мы расширили мониторинг рисков финансовых учреждений, деятельность или концентрация которых могут вызывать дополнительные опасения из-за экономических последствий пандемии. Кроме того, мы предоставили доступную макроэкономическую информацию по конкретным учреждениям, включая оценки совокупной уязвимости банковского сектора к кредитному риску и риску ликвидности.

  • Веб-страница: FDIC Quarterly Banking Profile
  • Выступление: Председатель FDIC Елена МакВильямс перед Советом по надзору за финансовой стабильностью (26 марта 2020 г.)
  • Свидетельские показания: Председатель FDIC Джелена МакВильямс по надзору за органами финансового регулирования в Комитете по банковскому делу, жилищному строительству и городским делам Сената США (12 мая 2020 г.)
  • Свидетельские показания: Председатель FDIC Елена МакВильямс перед Подкомитетом по защите прав потребителей и финансовым учреждениям, Комитет по финансовым услугам; U.С. Палата представителей (13 мая 2020 г.)
  • Подкаст FDIC: Эпизод 1 — Состояние банковского дела (20 июня 2020 г.)
  • Заявление: Председатель FDIC Елена МакВильямс о плане восстановления Фонда страхования вкладов (15 сентября 2020 г.)
  • Пресс-релиз: FDIC публикует результаты годового обзора депозитов (18 сентября 2020 г.)
  • Выступление: Председатель FDIC Елена МакВильямс на ежегодной конференции SRB «Готовность к разрешению споров: адаптация к нашему неопределенному миру» (8 октября 2020 г.)
  • Свидетельские показания: Председатель FDIC Елена МакВильямс о надзоре за органами финансового регулирования перед Комитетом Сената по банковскому делу, жилищному строительству и городским делам (10 ноября 2020 г.)
  • Свидетельские показания: Председатель FDIC Елена МакВильямс о надзоре за пруденциальными регулирующими органами: обеспечение безопасности, устойчивости, разнообразия и подотчетности депозитных учреждений во время пандемии до США.Комитет Палаты представителей по финансовым услугам (12 ноября 2020 г.)
  • Заявление: Председатель FDIC Елена МакВильямс о годовом отчете FSOC (3 декабря 2020 г.)

Интерфероны I типа влияют на метаболическую пригодность CD8 + Т-клеток у пациентов с системной красной волчанкой


Все пациенты с СКВ в исследовании соответствовали пересмотренным критериям Американской коллегии ревматологов 56 и критериям SLICC 57 и имел нефрит, подтвержденный биопсией.Подгруппы волчаночного нефрита (LN) были разделены на категории в соответствии с классификацией Международного общества нефрологов / Общества патологов почек. Пациенты, которые получали циклофосфамид и / или истощение В-клеток в течение 6 месяцев, были исключены. Для транскриптомного исследования 29 пациентов с СКВ были набраны из Imperial Lupus Center, подробности представлены в дополнительной таблице 1. Для клинических исследований использовались индекс активности системной красной волчанки (оценка SLEDAI) и индекс группы оценки волчанки на Британских островах (BILAG). классификация; активное заболевание было определено как SLEDAI> 6 и неактивное SLEDAI <4.Активное заболевание почек определялось как соотношение белок: креатинин в моче> 50 мг / ммоль вместе с подтвержденным биопсией уровнем III, IV или V LN в течение 3 месяцев после набора. Неактивное заболевание почек определялось как пациенты с подтвержденной биопсией ЛУ в анамнезе, принимавшие преднизолон в дозе ≤10 мг в день вместе с почечным доменом BILAG степени D, соотношение белок: креатинин <50 мг / ммоль и без изменений в лечении, связанном с СКВ. в течение 12 месяцев до приема на работу. Одиннадцать здоровых женщин-добровольцев (без семейного анамнеза аутоиммунных заболеваний) служили в качестве контрольной группы по возрасту и этнической принадлежности.Подробная информация о когорте СКВ и здоровых добровольцах, участвовавших в метаболических и функциональных исследованиях, суммирована в дополнительной таблице 3. Семь пациенток с РА были набраны в качестве контроля заболевания для метаболического исследования. Все пациенты дали информированное согласие, и образцы были собраны в виде подгруппы, зарегистрированной в банке тканей Imperial College Healthcare (лицензия: 12275; разрешение Национальной службы этики исследований 17 / WA / 0161). Комитет по управлению тканями банка тканей Imperial College Healthcare одобрил исследование (ref: R13010a).

Разделение РВМС и выделение Т-клеток

РВМС получали центрифугированием в градиенте плотности с использованием Lymphoprep (STEMCELL Technologies, Канада). Вкратце, примерно 50 мл крови разбавляли 1 × фосфатно-солевым буфером (PBS) с добавлением 2% FBS и наносили поверх 15 мл раствора Lymphoprep. Затем образец центрифугировали при 800 × g в течение 20 мин при комнатной температуре без перерыва. PBMC собирали с поверхности раздела и дважды промывали PBS / 2% FBS.Чтобы максимизировать чистоту Т-клеток CD4 + и CD8 + , Т-клетки сначала обогащали с использованием набора для выделения Т-клеток с отрицательной магнитной селекцией (Miltenyi Biotec) в соответствии с инструкциями производителя. Для метаболических исследований, как указано, отрицательно отобранные Т-клетки затем метили анти-CD4 и анти-CD8 антителами и сортировали с использованием Aria II FACS (Becton-Dickson). Для экспериментов по секвенированию РНК Т-клетки CD4 + и CD8 + были положительно выделены с использованием набора Dynabeads FlowComp Human CD4 или CD8 (Invitrogen) в соответствии с протоколом производителя.Средняя чистота, оцененная методом проточной цитометрии, составляла более 95%.

Для некоторых экспериментов с культивированием in vitro Т-клетки CD8 + выделяли из конусов лейкоцитарной пленки (NHSBT) от здоровых доноров. CD8 + Т-клетки очищали с использованием набора для выделения Т-клеток CD8 + человека (Myltenyi Biotec) в соответствии с протоколом производителя. Клетки центрифугировали и ресуспендировали в полной среде (CM), содержащей RPMI 1640, 10% инактивированного нагреванием FBS, 1% l-глутамина с пенициллин-стрептомицином, 0.1% 50 мМ β-меркаптоэтанола, 2% 1 М буферного раствора HEPES, 1% раствора незаменимых аминокислот MEM и 2% 100 мМ раствора пирувата натрия. Общее количество клеток подсчитывали путем окрашивания трипановым синим на гематоцитометре. Средняя чистота, оцененная методом проточной цитометрии, составляла более 85%.

Экстракция РНК и подготовка библиотеки

Общая РНК была экстрагирована с использованием наборов RNeasy Mini (Qiagen) в соответствии с инструкциями производителя, с дополнительной стадией очистки путем обработки ДНКазой на колонке с использованием набора для ДНКазы без РНКаз (Qiagen), чтобы гарантировать устранение любая геномная ДНК.Качество и концентрацию общей РНК анализировали с помощью спектрофотометра NanoDrop 1000 (ThermoFisher Scientific) и проверяли с помощью измерителя Qubit (Invitrogen). Все образцы общей РНК были подвергнуты измерению уровня деградации с использованием Agilent 2100 Bioanalyzer (Agilent Tech Inc.), и значения RIN для всех образцов были ≥9,0. Пятьсот нанограмм общей РНК из Т-клеток CD8 + или CD4 + использовали для создания библиотек РНК-seq с использованием набора TruSeq Stranded mRNA HT (Illumina, UK) в соответствии с инструкциями производителя.Вкратце, РНК очищали и фрагментировали с использованием магнитных шариков, связанных с поли-Т олиго, с использованием двух циклов очистки с последующим синтезом первой и второй цепей кДНК. Затем 3′-концы кДНК были аденилированы и адаптеры лигированы с последующим 11 циклами амплификации библиотеки. Библиотеки были отобраны по размеру с использованием очищенных гранул AMPure XP (Beckman Coulter) и их качество проверено с помощью Agilent 2100 Bioanalyzer. Образцы были рандомизированы, чтобы избежать пакетных эффектов, а мультиплексированные библиотеки были запущены на 12.5 дорожек платформы HiSeq 2500 (Illumina, BRC, Imperial College) для генерирования считываний парных концов 100 пар оснований.

Анализ последовательности РНК

Достигнута средняя глубина 48 М считываний на образец. Адаптеры секвенирования были удалены с помощью Trimmomatic (v.0.36), а качество чтения проверялось с помощью FastQC (v.0.11.2) до и после обрезки. Чтения были согласованы с геномом человека (GRCh48.primary_assembly.genome.fa; аннотация: gencode.v25.annotation.gtf) с использованием пакета tophat2 (v.2.1.0: -b2-sensitive, — library-type fr-firststrand) .Средний процент сопоставления составил 92,5%, а среднее количество правильно спаренных считываний составило 42,5 M (приблизительно 89%). Качество картирования, распределение считываемых данных, охват тела генами, содержание GC и загрязнение рРНК проверяли с помощью программного обеспечения Picard (v.2.6.0). Счетчики чтения на уровне генов были рассчитаны с использованием HT-Seq-count (v.0.6.1, аннотация: gencode.v25.annotation.gtf) 58 со строгим режимом «-m строго-пересечения». Гены с менее чем десятью выровненными считываниями во всех образцах были отфильтрованы как гены с низкой экспрессией, оставив 16874 экспрессированных гена из 58037 генов.Матрица количества фрагментов на килобазу экзонов на миллион отображенных считываний (FPKM) была рассчитана с использованием пакетов Rsubread (v.1.30.5) 59 и edgeR (v.3.22.3) 60 . Анализ дифференциальной экспрессии генов между группами выполняли с использованием DESeq2 (v.1.14.1), и сообщалось о значительно дифференцированно экспрессируемых генах с использованием кратного изменения в 1,5 раза и ниже 1% значения Бенджамини-Хохберга (BH), скорректированного P -значения. Чтобы визуализировать сходство между образцами, иерархическая кластеризация и PCA были выполнены с помощью pcaExplorer (v.2.6.0, https://github.com/federicomarini/pcaExplorer) и pheatmap (v 1.0.10, https://CRAN.R-project.org/package=pheatmap) соответственно. Графики вулканов дифференциально экспрессируемых генов были созданы с использованием пакета ggplot2 (v.3.0.0, https://cran.r-project.org/web/packages/ggplot2/index.html). Все этапы обработки необработанных данных РНК-seq были выполнены в высокопроизводительной кластерной вычислительной среде Cx1, Имперский колледж Лондона. Дальнейшие анализы проводились в среде R / Bioconductor v.3.4.4 (http://www.R-project.org/).

Анализ пути

Дифференциально экспрессируемые гены анализировали с помощью Cytoscape ClueGo v.2.3.3. (http://apps.cytoscape.org/apps/cluego) на основе онтологий генов (биологические процессы, молекулярные функции, процессы иммунной системы), Interpro, KEGG, Reactome и Wiki Pathways. Термины были названы расширенными на основе максимального значения P 0,05 и минимального перекрытия 3%. Go Term Fusion и группировка были выполнены. Обогащенные группы были дополнительно ранжированы в соответствии с группой, понизившееся значение Бонферрони P .Термины лидерства группы были определены внутри каждой группы как термин с наименьшим скорректированным значением обогащения P . Визуализация путей в наборах данных была выполнена с помощью программного обеспечения Cytoscape (V3.6.0). Анализ обогащения целевого метаболического пути был выполнен с использованием приложения Cytoscape Reactome Functional Interaction. Пути с максимальной вероятностью ложного обнаружения 0,05 были сохранены как значительно обогащенные.

Анализ GSVA и WGCN

Для определения путей, коррелирующих с активностью заболевания, были применены GSVA и WGCNA.Сигнатуры Т-клеток коррелировали с 84 клиническими критериями, включая множественные клинические системы оценки (ACR, BILAG, Physitors Global Assessment, SLEDAI, SLICC), параметры крови (например, антиядерные, анти-дцДНК и антитела против кардиолипина, лейкопения), клинические проявления (классификация волчаночного нефрита, поражение других органов и т. д.) и лечение (азатиоприн, гидроксихлорохин, микофенолят мофетил и т. д.).

GSVA v1.30.0 использовался для определения того, были ли конкретные биологические пути или сигнатуры значительно обогащены между активными инеактивные пациенты с СКВ. Априори определенный набор генов был получен из базы данных MSig (http://software.broadinstitute.org/gsea/msigdb). Вкратце, была сгенерирована матрица нормализованных логарифмически преобразованных данных экспрессии, и все гены были ранжированы в соответствии с уровнем экспрессии. Затем оценки обогащения (оценки GSVA) ​​были рассчитаны непараметрически с использованием статистики случайного блуждания, подобной Колмогорову-Смирнову (KS), для каждого набора генов в конкретной выборке. Значимость различий в показателях обогащения между клиническими категориями рассчитывалась с использованием критерия хи-квадрат и категорий со значениями P меньше 0.05 считались значительно обогащенными. Показатель обогащения GSVA для набора генов, участвующих в передаче сигналов IFN типа I (http://software.broadinstitute.org/gsea/msigdb/cards/REACTOME_INTERFERON_ALPHA_BETA_SIGNALING), использовался для проверки оценки ISM на основе qPCR, чтобы показать высокую корреляцию ( r 2 = 0,9132 коэффициент корреляции Пирсона). Чтобы изучить метаболические пути, на которые может влиять передача сигналов IFN типа I, оценка обогащения GSVA для каждого набора генов, связанного с метаболизмом, из баз данных BIOCARTA, KEGG и REACTOME (http: // software.broadinstitute.org/gsea/msigdb) коррелировали с показателем обогащения GSVA для набора генов, участвующих в передаче сигналов IFN типа I, с использованием Пирсона r .

WGCNA версии 1.68 была использована для идентификации сильно коррелированных генов в каждой подгруппе иммунных клеток. Матрица нормализованных, логарифмически преобразованных данных экспрессии была сгенерирована и использована в качестве входных данных для анализа WGCNA. Мягкая пороговая мощность была выбрана на основе критерия приблизительной безмасштабной топологии ( P = 15 для набора данных CD4 + Т-клеток и P = 16 для набора данных CD8 + Т-клеток).Были построены генные сети, и модули были идентифицированы из полученной топологической матрицы перекрытия с порогом корреляции несходства 0,01, используемым для объединения границ модулей, и указанным минимальным размером модуля n = 30. Модули были обобщены как сеть модульных собственных генов, которые затем коррелировали с матрицей клинических переменных, и полученная корреляционная матрица визуализировалась в виде тепловой карты. Достоверность корреляции между данным клиническим признаком и модульным собственным геном оценивалась с помощью линейной регрессии с поправкой Бонферрони для поправки на множественное тестирование.Биологическая значимость групп генов, составляющих модули, идентифицированные с помощью анализа коэкспрессии, была дополнительно исследована с использованием базы данных STRING v.11 (https://string-db.org/) для исследования межбелковых взаимодействий вместе с обогащением для путей KEGG и GO-терминов. (Биологический процесс).

Оценка кПЦР и ISM


РНК были преобразованы в кДНК с использованием набора для синтеза кДНК iScript (Bio-Rad, США) в соответствии с инструкциями производителя. кДНК затем разводили в буфере EB (Qiagen) до конечной концентрации 2.5 нг / мкл. Реакции КПЦР в реальном времени проводили с использованием Power SYBR Green Master Mix (Applied Biosystems, США), и специфичные для зонда праймеры перечислены в дополнительной таблице 4. Для каждой реакции ПЦР использовали 5 нг кДНК и 0,4 мкМ праймеров, а затем 8 мкл мастер-микс. Каждый образец анализировали в трех экземплярах. Для каждого мастер-микса во всех прогонах был включен нематричный контроль воды. Систему ViiA 7 (Life Technologies) использовали для измерения экспрессии генов. Процедуры ПЦР включали горячий старт при 95 ° C, 10 мин и 40 циклов при 95 ° C, 25 с; и 60 ° C, 60 с.Кривые плавления были исследованы для каждого гена по одному пику. Относительные уровни экспрессии генов были рассчитаны с использованием метода 2 −∆∆CT и получены путем нормализации к генам домашнего хозяйства 18S рибосомная РНК (рРНК ), ACTB (β-актин) или HPRT1 (гипоксантин). гуанинфосфорибозилтрансфераза 1). По материалам Kennedy et al. оценка ISM была рассчитана с использованием значений экспрессии из генов CMPK2 , EPSTI1 и HERC5 и нормализована с использованием гена домашнего хозяйства HPRT 27 .Оценка ISM была рассчитана из среднего значения CMPK2 , EPSTI1, и HERC5 пороговых значений цикла (Ct) — HPRT Ct (ΔCt) значений и умноженных на -1, чтобы получить правильную направленность относительного log2- масштабное выражение. Относительное частотное распределение значений ISM у пациентов с HC и SLE было вычислено для определения IFN-Neg SLE пациента как имеющего ISM <0,5 и IFN-High SLE пациентов как ISM> 1,5.

Обработка IFN типа I in vitro и стимуляция Т-клеток

PBMC или CD8 + Т-клетки выделяли из конусов лейкоцитов (NHSBT) из HC, как описано выше.PBMC (5,0 × 10 5 на лунку) или CD8 + Т-клетки (2,0 × 10 5 клеток на лунку) высевали в 96-луночные планшеты с U-образным дном в КМ, содержащем 10 Ед / мл рекомбинантного человеческого IL- 2 (Peprotech). Клетки обрабатывали человеческим универсальным IFN типа I (человеческий интерферон альфа A / D [BglII]; R&D System, США; 1000 Ед / мл или другие дозы, как указано) или оставляли без обработки. Как указано, клетки либо обрабатывали Т-активатором CD3 / CD28 человека Gibco Dynabeads (соотношение гранул к клеткам 1: 4), либо оставляли без обработки.Затем клетки инкубировали при 37 ° C в увлажненной атмосфере, содержащей 5% CO 2 в течение 2 или 7 дней со сменой CM на 3 день. В конце культивирования клетки анализировали проточной цитометрией или сортировали клетки и анализировали с помощью анализатора внеклеточного метаболического потока (см. ниже). Для экспериментов по повторной стимуляции гранулы CD3 / CD28 удаляли из культуры PBMC на 7 день и клетки оставляли на ночь. После этого очищенные Т-клетки CD8 + повторно высевали в количестве 2,0 × 10 5 клеток на лунку и повторно стимулировали Т-активатором CD3 / CD28 человека Gibco Dynabeads (соотношение гранул к клеткам, как указано).Через 4 или 24 часа обработки клетки окрашивали на маркеры активации и анализировали проточной цитометрией. Цитокины IFNγ, TNFα и гранзим B в супернатанте измеряли с использованием коммерческих наборов для ELISA, перечисленных в дополнительной таблице 4, в соответствии с протоколом производителя.

Анализ проточной цитометрии

Список антител, используемых для проточной цитометрии, показан в дополнительной таблице 4. Чтобы исключить мертвые клетки из окрашивания, использовали набор для окрашивания Live / dead Fixable Aqua (Molecular Probes, Life Technologies) в соответствии с инструкциями производителя. .Окрашивание проводили в присутствии насыщающей концентрации раствора для блокирования рецепторов Fc с использованием Human TruStain FcX ™ (Biolegend). Для окрашивания внутриклеточного белка клетки инкубировали в 1 × буфере BD Fix / Perm ™ (BD Biosciences) в течение 20 минут при 4 ° C. Клетки промывали 1 × буфером BD Perm / Wash ™ (BD Biosciences) и инкубировали с антителами в течение 30 мин. После промывания буфером BD Perm / Wash ™ клетки ресуспендировали в буфере FAC (PBS с добавлением 0,1% BSA, 2 мМ EDTA и 0.09% азид натрия).

Митохондриальный фенотип оценивали с использованием митохондриально-специфичных флуоресцентных зондов (дополнительная таблица 4). 5 × 10 5 клеток суспендировали в 200 мкл CM и обрабатывали митохондриальными зондами в указанных концентрациях. Клетки инкубировали в течение 30 минут при 37 ° C в увлажненной атмосфере, содержащей 5% CO 2 перед сбором для анализа проточной цитометрии. Все образцы собирали на проточном цитометре LSRFortessa (BD Biosciences, США), а данные анализировали с помощью программного обеспечения FlowJo, версия 10 (Tree Star Inc.Ashland, OR, США)

Анализ внеклеточного метаболического потока

CD4 + и CD8 + Т-клетки были отсортированы ex vivo или из культур PBMC на 7-й день с использованием FAC Aria II (BD Biosciences). Метаболический профиль отсортированных клеток (чистота> 95%) анализировали с использованием набора XF Cell Mito Stress (Agilent Technologies, США). Вкратце, 3,0 × 10 5 клеток суспендировали в среде XF (среда Seahorse XF RPMI, 2 мМ l-глутамин, 1 мМ пируват и 25 мМ глюкоза). Клетки высевали на планшет XF96 (Agilent Technologies, США), предварительно покрытый 22.4 мкг / мл адгезива для клеток и тканей Cell-Tak (Corning, США). Культуру уравновешивали в течение 1 ч при 37 ° C, а затем измеряли OCR (пМоль / мин) и ECAR (м / ч / мин) в базовых условиях и в ответ на 1 мкМ олигомицина, 2 мкМ фторкарбонилцианидфенилгидразона (FCCP), 1 мкМ ротенона. и 1 мкМ антимицина А с использованием анализатора внеклеточного потока XFe96. Все измерения повторяли, по крайней мере, три раза из 3–0–3-минутного цикла «смешивание-ожидание-измерение». Все образцы были проанализированы в трех или четырех повторностях. Метаболические параметры рассчитывались согласно Gubster et al.публикация 61 . Для экспериментов по рестимуляции 7-дневных культур PBMC гранулы CD3 / CD28 удаляли на 7 день и клетки оставляли нестимулированными на ночь. После этого CD8 + Т-клетки были отсортированы и 2,0 × 10 5 клеток были суспендированы в среде XF с низким содержанием глюкозы (среда Seahorse XF RPMI, 2 мМ l-глутамина, 1 мМ пируват и 10 мМ глюкоза) и посеяны на планшет XF96, предварительно покрытый 22,4 мкг / мл клеточного и тканевого адгезива Cell-Tak. Через 30 мин шарики CD3 / CD28 (соотношение шариков к клеткам 4: 1) или форбол-12-миристат-13-ацетат (PMA) / иономицин (конечная концентрация 100 нг / мл PMA и 500 нг / мл иономицина) наносили непосредственно на посеянные клетки. через порты многократного впрыска на приборе.ECAR и OCR записывались на время эксперимента (120 мин).

Количественное определение АТФ

Содержание АТФ в отсортированных Т-клетках CD4 + и CD8 + оценивали с использованием набора для биолюминесцентного анализа АТФ (Abcam). Клетки ресуспендировали при 1 × 10 6 / мл в не содержащем фенола RPMI 1640 и 50 мкл клеточной суспензии (5,0 × 10 4 клеток) затем добавляли к 50 мкл реакционной смеси, содержащей фермент для мониторинга АТФ и буфер для высвобождения нуклеотидов. Стандарты готовили в 10-кратных разведениях (диапазон от 1000 мкМ до 1 × 10 -6 мкМ).Люминесценцию измеряли с помощью планшет-ридера FluoStar Omega (BMG Labtech, США). Все образцы были проанализированы в трех экземплярах, и уровень АТФ был интерполирован по стандартной кривой.

Число копий ДНК, кодируемой митохондриями

Полную ДНК экстрагировали из отсортированных по клеткам CD4 + и CD8 + Т-клеток с использованием реагента ДНКзол в соответствии с инструкциями производителя (Invitrogen). Число копий мтДНК определяли как общее количество копий тРНК, кодируемой мтДНК (мтДНК-тРНК-F: CACCCAAGAACAGGGTTTGT; мтДНК-тДНК-R: TGGCCATGGGTATGTTGTTA), деленное на количество копий, кодируемых nDTAT-кодируемым TTCT: B2GCCTTTT: TGCCTTT: FTCDTCT: NDNAT: FCCCTT: B2GCCTT; ) копии.Для каждой реакции 3 мкл образца ДНК (1 нг / мкл) амплифицировали в 10-мкл реакционного буфера, содержащего 1 мкл (5 мкМ) каждого праймера и 5 мкл Master Mix Power SYBR Green PCR (Invitrogen). qPCR выполняли на машине ViiA 7 System (Life Technologies), как описано выше. Одновременно 3 мкл ПЦР класса H 2 O были включены в качестве отрицательного контроля, соответственно. Результаты были выражены как количество копий мтДНК, как сообщалось ранее 62 .

Анализ клеточной смерти

PBMC от пациентов с СКВ и HC держали в культуре в течение 48 часов в CM.Клетки дважды промывали PBS, а затем окрашивали на аннексин V и пропидий йодид (PI) с использованием набора для обнаружения апоптоза FITC-Annexin V (BD Bioscience, Гейдельберг, Германия) в соответствии с протоколом производителя. Вкратце, PBMC ресуспендировали в связывающем буфере аннексина V, FITC-аннексин (5 мкл) добавляли к клеточной суспензии, содержащей 2,5 × 10 5 клеток. Суспензию клеток перемешивали осторожным встряхиванием и затем инкубировали в течение 15 мин при комнатной температуре в темноте. Затем добавляли 250 мкл связывающего буфера и PI (1 мкл), и клетки анализировали с помощью проточной цитометрии с использованием BD LSRFortessa (BD Bioscience, Гейдельберг, Германия).Для экспериментов по рестимуляции PBMC оставляли в покое в течение ночи перед меткой 1 мкМ метки CFSE. Затем клетки повторно высевали в количестве 2,0 × 10 5 клеток на лунку и повторно стимулировали Т-активатором CD3 / CD28 человека Gibco Dynabeads (соотношение гранул к клеткам 1: 4, 1: 8 или 1:16, как указано). . Через 3 дня клетки окрашивали на PB-аннексин V (разведение 1: 100) и анализировали проточной цитометрией.

Микроскопия со структурированным освещением

Изолированные CD8 + Т-клетки из IFN-Neg ( n = 3) и IFN-High ( n = 3) Пациенты с СКВ были посеяны на поли-l-лизин, покрытый с высокой точностью. покровные стекла (1.5H, Marienfeld GmbH & Co.) и затем фиксировали в 4% формальдегиде (мас. / Об.) Плюс 4% сахарозы (мас. / Об.) В 50% PBS (GIBCO) в течение 20 мин при комнатной температуре. Затем лимфоциты пермеабилизировали 0,1% Triton X-100 в PBS (5 мин). Желатин рыбьей кожи (Sigma, 0,2% мас. / Об.) Использовали для уменьшения неспецифического связывания антител. Фиксированные лимфоциты подвергали действию первичных антител против Tom20 (FL-145, sc-11415, Santa Cruz Biotechnology, Inc) и против CD8 альфа (ab199016, Abcam) при 4 ° C в течение ночи. После промывания лимфоциты метили козьими антителами против кроличьего Alexa 488 (Invitrogen) и козьими антителами против мыши Alex 568 (Invitrogen), соответственно, в течение 1 часа при комнатной температуре.Ядра окрашивали DAPI. Слайды были закреплены на антибликовой среде Vectashield H-1000 (Vector Labs). Лимфоциты визуализировали с помощью SR-SIM, выполненного с помощью Zeiss Elyra S.1 (Carl Zeiss Microimaging) с использованием масляной линзы Plan-Apochromat 63 × / 1,4 и иммерсионного масла (Zeiss Immersol, 518 ° F / 30 ° C). Изображения были получены с использованием пяти фазовых сдвигов и трех вращений сетки с размером шага по оси z 0,1 мкм и сняты камерой sCMOS (pco.Edge 4.2). Использовалась следующая установка лазера и фильтра: Alexa 568 возбуждалась лазером с длиной волны 561 нм и излучаемый свет собирался с помощью фильтра BP 420–480 + BP 570–640 + LP 740; Alexa 488 возбуждали лазером 488 нм и излучали свет, собираемый фильтром BP 420–480 + BP 495–550 + LP 650; DAPI возбуждали лазером с длиной волны 405 нм и излучаемый свет собирался с помощью фильтра BP 420–480 + BP 495–550 + LP 650.Изображения были реконструированы с использованием программного обеспечения ZEN 2012 SP4 (Black), версия (Carl Zeiss Microimaging). Выравнивание каналов было достигнуто путем визуализации разноцветного слайда с одинаковыми настройками получения изображения. Трехмерные реконструкции были получены с использованием программного обеспечения Imaris 9.5.1 (версия 9.5.1, Bitplane AG). Инструмент Imaris «Cells» был использован для идентификации клеток CD8 + и создания трехмерных поверхностей митохондрий посредством установления порога флуоресцентного канала TOM20. Отрисовки поверхности менее 0.025 мкм размером 3 считались фоном и исключались. Митохондриальные изображения также оценивались двумя слепыми исследователями (диапазон 14–43 митохондриальных изображений на образец; три пациента с IFN-Neg и три пациента с СКВ с высоким уровнем IFN). Процент CD8 + Т-клеток со слитыми митохондриями рассчитывали как общее количество клеток, оцененных как слитые, деленное на общее количество клеток, отображаемых в каждом образце.


NAD + / NADH и обработка NMN in vitro

CD8 + Т-клетки выделяли из конусов лейкоцитов (NHSBT) из HC с использованием набора для выделения Т-клеток CD8 + (Myltenyi Biotec) в соответствии с протоколом производителя.CD8 + Т-клетки (2,0 × 10 5 клеток на лунку) высевали в 96-луночные планшеты с U-образным дном в КМ, содержащем 10 Ед / мл рекомбинантного человеческого ИЛ-2 (Peprotech) и человеческого Т-активатора CD3 от Gibco Dynabeads. / CD28 (соотношение гранул к клеткам 1: 4), с IFN типа I или без него (человеческий интерферон альфа A / D; R&D System, США; 1000 Ед / мл). Затем клетки инкубировали при 37 ° C в увлажненной атмосфере, содержащей 5% CO 2 в течение 7 дней. На 3 день в клетки добавляли 1 мМ NMN или без него (Sigma-Aldrich).На 7 день из культуры удаляли гранулы CD3 / CD28 и оставляли клетки на ночь. CD8 + Т-клетки были положительно отобраны с использованием набора Dynabeads FlowComp Human CD8 Kit (Invitrogen) для достижения чистоты более 99%, а затем использованы для: i) ответа митохондриального дыхания на TCR (соотношение гранул к клеткам 4: 1) и PMA / иономицин ( конечная концентрация (100 нг / мл PMA и 500 нг / мл иономицина) при стимуляции с использованием анализатора внеклеточного метаболического потока, как описано выше. ii) Соотношение NAD + / NADH: 2,0 × 10 6 CD8 + Т-клетки были лизированы и соотношение NAD + / NADH определено количественно с использованием специального набора (Abcam, ab65348) в соответствии с инструкциями производителя.Все значения OD450 нм (микропланшетный ридер FluoStar Omega, BMG Labtech, США) были скорректированы до холостых контролей. Используя значения OD450 нм, соотношение НАД + / НАДН рассчитывали как: (Общий НАД + / НАДН) — НАДН / НАДН. iii) жизнеспособность клеток: CD8 + Т-клетки (2,0 × 10 5 клеток на лунку) повторно стимулировали Т-активатором CD3 / CD28 человека Gibco Dynabeads (соотношение гранул к клеткам 1: 2). Через 24 часа клетки окрашивали MitoSOX Red, а через 3 дня — аннексином V / PI, как описано выше.

Статистический анализ

Данные анализировали с помощью программного обеспечения GraphPad Prism, версия v.9.0.1 (GraphPad Software, Inc., Ла-Хойя, Калифорния, США). Если не указано иное, графики показывают среднее значение и SEM для каждой группы. Односторонний дисперсионный анализ ANOVA и знаковый ранговый критерий Уилкоксона для согласованных пар использовали для расчета значимых различий между несколькими или двумя видами лечения, соответственно. Значимость основана на значении P менее 0,05.

Сводка отчетов

Дополнительная информация о дизайне исследований доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

Добавить комментарий

Ваш адрес email не будет опубликован.