Рсв нулевой образец: Как заполнить РСВ нулевой в 2021 году

Содержание

Как заполнить РСВ нулевой в 2021 году

По страховым взносам, начисленным с выплат работникам, компании и ИП ежеквартально представляют в ИФНС установленную отчетность – «Расчет по страховым взносам» (РСВ). А что делать, если зарплата не начислялась, и взносов к уплате нет? В каких случаях необходимо представить отчет и как заполнить нулевую РСВ в 2021 году – об этом пойдет речь в нашем материале.

В каких случаях представляется РСВ нулевой

Согласно п.7 ст. 431 и пп.1 п. 1 ст. 419 НК РФ Расчет по страхвзносам обязаны представлять юридические лица и ИП, выплачивающие доходы физлицам. При этом к облагаемым выплатам относят:

  • зарплату наемных работников;
  • вознаграждение по договорам ГПХ.

Получается, что юридические лица в любом случае относятся к плательщикам взносов, поэтому отчетность обязаны представить даже при отсутствии выплат.

С ИП дело обстоит иначе: он может вести деятельность самостоятельно, в одиночку, не привлекая сторонних работников. Поэтому расчет по страховым взносам нулевой в 2021 г. с предпринимателя будут требовать только в том случае, если он уже заявлялся ранее как работодатель, то есть:

ИП, никогда не нанимавшие работников и не заключавшие договоры ГПХ, «Расчет по страховым взносам» нулевой могут не представлять. С такой позицией согласны, например, в УФНС России по Удмуртской Республике, опубликовавшем свои разъяснения 17.08.2017 на ]]>

официальном сайте]]>.

Согласно разъяснениям из письма ФНС от 03.04.2017 № БС-4-11/6174, нулевой расчет позволяет отделить плательщиков взносов, нарушающих сроки сдачи Расчета, от тех, кто в соответствующем периоде не производил выплат работникам и не начислял взносы, т.е. фактически не вел деятельность, и поэтому налоговики требуют РСВ со всех страхователей, включая ИП, кто когда-либо производил выплаты физлицам.

Форма РСВ для нулевого отчета

При отсутствии деятельности используется установленная форма «Расчета по страховым взносам» 2021 г. Бланк нулевой отчетности тот же, что и для обычного Расчета: вместе с Порядком заполнения он утвержден приказом от 18.09.2019 № ММВ-7-11/[email protected] (в ред. от 15.10.2020). Отчитываться на бумаге разрешено компаниям и ИП, у которых численность персонала не превышает 10 человек, остальные должны соблюдать электронный формат. При отсутствии деятельности количество работающих лиц обычно не превышает установленный показатель, поэтому можно выбрать как электронную, так и бумажную форму. При этом подаются не все листы Расчета, а только некоторые из них.

Обязательные разделы РСВ – 2021 (нулевой отчетности)

Состав РСВ с нулевыми показателями значительно меньше обычного. Страхователю достаточно заявить о том, что выплаты не производились, представив обязательные разделы Расчета:

  • титульный лист;
  • раздел 1;
  • раздел 3.

Такой состав для нулевого РСВ утвержден п. 4.2 Порядка заполнения Расчета.

Как заполнить нулевой расчет по страховым взносам

Требования, предъявляемые к оформлению расчета, стандартны: односторонняя печать, все листы должны быть пронумерованы, исправлять показатели нельзя. При заполнении:

  • В стоимостных и количественных показателях в первой ячейке ставится «0», остальные ячейки прочеркиваются.
  • Пустые текстовые поля при заполнении прочеркиваются.
  • Текст пишется заглавными печатными буквами.
  • ИНН и КПП плательщика указываются вверху каждой страницы.
  • Страницы нумеруют по порядку, начиная с «001».

На титульном листе, как обычно, указываются сведения о компании или ИП. Начиная с отчета за 2020 г., на титуле проставляется среднесписочная численность работающих лиц.

В разделе 1 в стр. 001 «Тип плательщика» указывается код «2» — этот шифр означает, что выплат физлицам в последнем квартале не производилось, поэтому отчетность нулевая.

Раздел 3 должен быть заполнен на каждого человека, трудоустроенного в компании. Общее число разделов 3 должно соответствовать количеству сотрудников, несмотря на то, что начислений по ним нет (п. 21.2 Порядка заполнения). Если компания не ведет деятельность, а сотрудники отсутствуют, в отчете присутствует лишь один лист с разделом 3 – со сведениями о руководителе организации.

Покажем, как оформляется «Расчет по страховым взносам» нулевой. Образец заполнения представлен по компании, в которой нет сотрудников, кроме директора.

Сдать нулевую отчетность надо в те же сроки, что и расчет с начислениями – в течение 30 дней после завершения квартала (п. 7 ст. 431 НК РФ).

Порядок заполнения формы РСВ при нулевом размере тарифа по взносам

В отношении юридических лиц и индивидуальных предпринимателей, осуществляющие свою деятельность в отраслях наиболее пострадавших от пандемии, было принято решение об отмене страховых взносов за 2 квартал текущего года (Подробнее читайте в статье: «Как реализуется освобождение от налогов и страховых взносов за 2 квартал»).

Однако, отчетность по форме РСВ необходимо предоставить в установленные сроки, то есть до 30 июля 2020 года. По этому вопросу налоговая инспекция выпустила множество писем, рекомендаций и пояснений. Рассмотрим, как сдавать РСВ по новым нормам.

Льготные тарифы по страховым взносам для предприятий

Затронувшая нашу страну коронавирусная инфекция, явилась причиной множества изменений в размеренной жизни налогоплательщиков. Изначально было принято решение о снижении тарифа страховых взносов до 15 % для представителей малого и среднего бизнеса

После было принято установить нулевой тариф страховых взносов за II квартал 2020 года. Такой тариф будет применяться ко взносам по обязательному медицинскому, пенсионному и социальному страхованию. Нулевая ставка по взносам будет применяться к юридическим лицам, осуществляющим свою деятельность в отраслях, наиболее пострадавших в период пандемии коронавируса.

Из вышесказанного выходит, что расчет по страховым взносам будет предоставляться организациями в налоговую инспекцию по трем видам тарифов: обычный, пониженный и нулевой.

Нюансы при заполнении формы при льготных тарифах

Даже если субъект малого и среднего предпринимательства полностью освобожден от страховых взносов, отчет по форме РСВ все равно нужно предоставить в налоговую. ФНС объяснила, что отчет за 2 квартал в таком случае нужно будет сдать с нулевыми показателями. Если отчет был сдан ранее с ненулевыми данными, то потребуется подача уточняющей формы.

Бланк для заполнения формы остался таким же, как и на начало года. В расчете из страховых взносов заполнению подлежат:

  • титульный лист
  • раздел 1
  • приложения 1 и 2 к разделу 1
  • раздел 3

Раздел 2 не будет рассмотрен, поскольку заполняется только в отношении глав крестьянско-фермерских хозяйств.

Титульный лист и раздел 1 заполняются, как и в предыдущие отчетные периоды, изменения их не коснулись.

Напоминаем, что по соответствующим строкам 030-120 указываются общие суммы взносов с начала года, а по строкам соответствующим месяцам расчетного периода, необходимо поставить прочерки, так как фактически суммы отсутствуют.

По строке 001 необходимо поставить 1 или 2 в зависимости от того производились ли выплаты физическим лицам за расчетные месяцы.

Раздел 1. Сводные данные об обязательствах плательщика страховых взносов

В отношении приложений появились уточнения ФНС.

Заполнение приложений 1 и 2 к разделу 1 формы РСВ

Данные приложения необходимо заполнить дважды: по обычному тарифу и 0%.

При заполнении по первому варианту по строке 001 отразите значение «01» и укажите все значения только в графе 1, здесь будут отражаться фактические данные за январь—март 2020 года. Сведения по столбцам 2-4 будут отражены в отдельном экземпляре.

Приложение 1. Код тарифа «01»

Раздел 1. РСВ с нулевым тарифом

При заполнении нулевого экземпляра в сроке 001 пропишите «21». Отразите здесь данные только за 2 квартал – в обобщенной сумме и в разрезе каждого месяца. По строке 060 укажите нули во всех окошках.

Нумерация страниц производится сквозной нумерацией.

Приложение 1. Код тарифа «21»

Раздел 1. РСВ с нулевым тарифом

Необлагаемые выплаты отражаются в зависимости от месяца, к которому они относятся. Например, мартовские суммы отразить в экземпляре с отметкой

«01», а июньские с «21».

Заполнение раздела 3 формы РСВ

В третьем разделе формы отразите персонифицированные сведения работников в единственном экземпляре по тарифу 0%. По 130 укажите категорию работника, это может быть:

  • КВ – если сотрудник является гражданином Российской Федерации
  • ВПКВ – работник имеет статус временно пребывающего
  • ВЖКВ – работник имеет статус временно пребывающего, но является застрахованным в ОПС

В остальном порядок заполнения остался прежним, только место сумм доходов и взносов нужно проставить нули.

Раздел 3. Персонифицированные сведения о застрахованных лицах

Предпринимателям малого и среднего бизнеса, которые не попали в список наиболее пострадавших от коронавирусной инфекции , тоже будет предоставлена льгота при расчете страховых взносов за 2 квартал текущего года. Их взносы будут рассчитываться

по пониженному тарифу 15 % и рассчитываться с той части заработной платы, которая превышает МРОТ.

Контрольные соотношения

Федеральная налоговая служба опубликовала новые контрольные соотношения в письме ФНС РФ от 10.06.2020 N БС-4-11/9607. Эти данные дополняют существующие ранее правила проверки формы РСВ.

Разработали три дополнительных правила, но принцип у них идентичен.

Рассмотрим пример: «При наличии подр 1.1 прил. 1 р. 1 СВ по значению поля 001 прил. 1 р. 1 СВ = 21 обязательность соблюдения условий для применения пониженных тарифов страховых взносов, установленных статьей 3 Федерального закона от 08.06.2020 N 172-ФЗ»

Эти же правила распространяются на подраздел 1.2 приложения 1, а также приложения 2.

Из этого следует, что заполнять нулевую форму РСВ с кодом «21» организация имеет право только в том случае, если ее деятельность попадает под требуемые федеральным законом условия. Налоговая инспекция будет пристально проверять этот факт.

Читайте также: «Издан список предприятий для плановых проверок Роструда».

Пример заполения образец заполнения нулевой РСВ-1 2013 инструкция по заполению

Как заполнить нулевую РСВ-1 форма 2013 года самостоятельно. Пример составления нулевой декларации РСВ-1 форма 2013 года

 

С первого квартала 2013 года нужно сдавать отчет в Пенсионныйи фонд по новой форме (Приказ от 4 марта 2013 г. N 27441)

 

Скачать РСВ-1 (форма 2013 года)

 

Скачать образец заполнения декларации РСВ-1 (форма 2013 года)

 

Данные, выделенные красным шрифтом необходимо заменить на свои.

 

В нулевой декларации РСВ-1 мы заполняем только 3 страницы (посмотрите образец)

 

Регистрационный номер ПФР необходимо указать в соответствии с записью в Извещении страхователя.

 

Регистрационный номер ТФОМС можно узнать в Едином государственном реестре юридических лиц. Если у вас нет данных, вы можете запросить выписку из ЕГРЮЛ или же обратиться в отделение Территориального фонда обязательного страхования в Вашем регионе с просьбой предоставить дубликат свидетельства о регистрации в ТФОМС.

 

ИНН и КПП указывается согласно Свидетельству о постановке на учет в налоговом органе юридического лица.

 

Коды ОКАТО, ОКВЭД, ОКПО, ОКОПФ, ОКФС можно посмотреть в информационном письме об учете в статрегистре росстата.Если у вас нет этих данных можно воспользоваться интернет-ресурсом www.okpo.ru

 

Так как РСВ-1 нулевая, деятельность не велась, заработная платане начислялась и в фирме числится один директор в строке количество звтрахованных лиц ставим 1, а в строке среднесписочная численность0.

 

Не забудьте проставить номера страниц, указать, наименование фирмы, отчетный период (по инструкции в декларации), календарный год, адрес фирмы, дата, подпись.

 

Так как отчет нулевой на второй и третьей странице мы ничего незаполняем кроме номера ПФР (такой же как и на первой странице), номеров страниц, даты и подписи руководителя.

 

Декларация РСВ-1 сдается в Пенсионный фонд каждый квартал до 15 числа включительно второго месяца (то есть за первый квартал до 15 мая, за второй квартал — до 15 августа и т.д.

 

РСВ-1 составляется в двух экземплярах и сдается:

 

  • -непосредственно Пенсионный фонд оба экземпляра (один экземпляр со штампом пенсионного остается у вас на руках)
  • -по почте ценным письмом с описью вложения (один экземпляр вы оставляете себе, к нему необходимо сохранить опись со штампом почты и почтовую квитанцию)

 

 

Пример заполнения и руководство по заполнению нулевого баланса

Пример заполнения и руководство по заполнению нулевого отчета о прибылях и убытках

Пример заполнения и руководство по заполнению единой упрощенной декларации

Пример заполнения и руководство по заполнению отчета 4-ФСС

РСВ-1 ПФР — образец заполнения и инструкция по каждому разделу 2019

Коммерсанты и организации обязаны предоставлять в пенсионный фонд России не только персональные сведения, но и заполнять отчет по форме РСВ-1. В документе содержится много информации, которая попадает не только в ПФР, но и в ОМС (мед. страх.)

На нашем примере рассмотрим образец заполнения РСВ-1 ПФР . Работодатели заполняют те разделы формы, которые им требуются. Обычно заполняют 1, 2, 6 разделы и при необходимости раздел 4.

Зачем заполняется РСВ-1

Любая организация обязана заполнять справку по форме РСВ-1. Эта аббревиатура расшифровывается так «Расчет по начисленным и уплаченным страховым взносам». Под уплаченными и начисленными понимаются взносы в ПФР и мед. страх.

Документ отражает все суммы, уплаченные за конкретного работника и направленные на следующие цели:

На формирование пенсии по страховой части
На накопительную часть
Мед. страхование (федеральный)
Региональный мед. страх

Законодательно установлено:

  • под расчетным периодом для РСВ-1 понимается календарный год;
  • отчетным периодом является один квартал.

Этот документ формируется и сдаётся в контролирующий орган ежеквартально. Срок сдачи документа — 15-е число первого месяца после каждого квартала. На примере рассмотрим, как правильно заполнять справку РСВ-1.

Титульный лист

Любой документ в гос. органы при заполнении имеет первый лист (титульный). В него нужно внести следующие сведения:

  • Данные о работодателе (страхователе). Указывается название организации (можно в сокращенном варианте), далее обязательно нужно указать ИНН и КПП, код экономической деятельности (этот код выдает налоговая инспекции при регистрации нового юр. или физ. лица), регистрационный номер в ПФР. Далее указывается контактный телефон страхователя.
  • Проставляется код отчетного периода, когда формируется данный документ.
  • В обязательном порядке указывается количество застрахованных лиц, на которых представляются сведения в документе.
  • Дата и подпись руководителя на первом (титульном) листе справки.

Кстати, подпись руководителя компании должна стоять на всех листах документа. Чтобы у ответственного лица не возникало вопроса, как заполнить РСВ-1рассмотрим дальше на примере заполнения каждого раздела.

Заполнение раздела 1 РСВ-1

После заполнения первого листа формы можно приступить к заполнению раздела 1 РСВ-1:

В этом разделе отражают данные, которые были начислены и уплачены на страховые взносы в ПФР и мед. страх. Главное, вносить корректные цифры. Этот раздел должен быть заполнен всеми страхователями-работодателями. Он включает в себя данные по всем сотрудникам целиком.

Например, если за работников перечисленные взносы составляют 5 000, эта сумма должна быть отражена.

Заполнение раздела 4 формы

Раздел 4 РСВ-1 заполняется страхователями только тогда, когда в отчетном периоде (квартале) были произведены доначисления страховых взносов. Нужно будет отразить суммы, которые доплачивались в гос. органы, или суммы, которые уменьшают страховые взносы на следующий период.

В графе 2 раздела 4 указывается основание, по которому производились эти начисления:

  • Камеральная проверка—1.
  • Выездная проверка—2.
  • Исправление ошибок—3.
  • Корректирование базы за прошлые периоды, когда ошибок не было выявлено—4.

Графа 3 раздела 4 указывает код основания для доначисленных взносов.

Как уже отмечалось, не все организации заполняют данный раздел.

Заполнение раздела 6 справки

Заполнение раздела 6 РСВ-1 желательно начинать после заполнения первого листа формы. В нем в обязательном порядке вносятся следующие данные:

  • ФИО сотрудника.
  • СНИЛС работника.
  • Сумма, которая начислялась сотруднику в виде премий, зарплаты или иного вознаграждения.
  • Сумма, которая взымалась с сотрудника на уплату страховых взносов.
  • Обязательно указывать даты начала и конца деятельности работника за последние три месяца отчётного квартала. По этим данным пенсионный фонд определит, сколько времени сотрудник проработал в данной структуре и общий стаж работы.

Есть в этом разделе подраздел 6.6, туда вносятся данные тогда, когда по сотруднику производились корректирующие сведения.

Раздел 6.7 заполняется тогда, когда было начисление по дополнительным тарифам. После того как был заполнен раздел 6, можно приступать к заполнению первого раздела справки. Сведения, которые были внесены в раздел 6 по каждому сотруднику, в разделе 1 отражаются по всему коллективу целиком.

Заполняя документ, ответственные лица должны внимательно вносить все данные, чтобы не было ошибок.

Как заполнить РСВ-1 в программе 1С Бухгалтерия 8.3, смотрите в этом видео:

Любая ошибка и несвоевременное предоставление отчетности накладывают на коммерсантов-работодателей и на организации штрафы в размере 5% от суммы неуплаченного взноса. Заполняя и сдавая документы, нужно быть предельно внимательными.

Обнаружение дефектных геномов респираторно-синцитиального вируса в носовых секретах связано с различными клиническими исходами.

  • 1.

    Hall, C. B. et al. Бремя респираторно-синцитиальной вирусной инфекции у детей раннего возраста. N. Engl. J. Med. 360 , 588–598 (2009).

    CAS PubMed PubMed Central Google Scholar

  • 2.

    Исследовательская группа по исследованию этиологии пневмонии для здоровья детей (PERCH).Причины тяжелой пневмонии, требующей госпитализации у детей без ВИЧ-инфекции из Африки и Азии: многострановое исследование методом случай-контроль PERCH. Ланцет 394 , 757–779 (2019).

    Google Scholar

  • 3.

    Falsey, A. R., Hennessey, P. A., Formica, M. A., Cox, C. & Walsh, E. E. Инфекция респираторно-синцитиальным вирусом у пожилых людей и взрослых из групп высокого риска. N. Engl. J. Med. 352 , 1749–1759 (2005).

    CAS PubMed Google Scholar

  • 4.

    Shi, T. et al. Глобальные, региональные и национальные оценки бремени острых респираторных инфекций нижних дыхательных путей, вызванных респираторно-синцитиальным вирусом, у детей младшего возраста в 2015 г .: систематический обзор и исследование на основе моделирования. Ланцет 390 , 946–958 (2017).

    PubMed PubMed Central Google Scholar

  • 5.

    Meissner, H.C. et al. Иммунопрофилактика с паливизумабом, гуманизированным моноклональным антителом к ​​респираторно-синцитиальному вирусу, для профилактики респираторно-синцитиальной вирусной инфекции у младенцев с высоким риском: общее мнение. Pediatr. Заразить. Дис. J. 18 , 223–231 (1999).

    CAS PubMed Google Scholar

  • 6.

    Schmidt, R. et al. Паливизумаб в профилактике тяжелой респираторно-синцитиальной вирусной инфекции у детей с врожденными пороками сердца; новое исследование моделирования затрат и полезности, отражающее научно обоснованные клинические пути в Испании. Health Econ. Ред. 7 , 47 (2017).

    PubMed PubMed Central Google Scholar

  • 7.

    Cai, W. et al. Факторы риска госпитализированного респираторно-синцитиального вируса и его тяжелые исходы. Вирусы гриппа, другие респира 14 , 658–670 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 8.

    Garofalo, R.P. et al. Макрофагальный воспалительный белок-1альфа (не цитокины Т-хелперов 2 типа) связан с тяжелыми формами респираторно-синцитиального вирусного бронхиолита. J. Infect. Дис. 184 , 393–399 (2001).

    CAS PubMed Google Scholar

  • 9.

    Гирдинк Р. Дж., Пиллэй Дж., Мейярд Л. и Бонт Л. Нейтрофилы при респираторно-синцитиальной вирусной инфекции: мишень для профилактики астмы. J. Allergy Clin. Иммунол. 136 , 838–847 (2015).

    CAS PubMed PubMed Central Google Scholar

  • 10.

    Heinonen, S. et al. Иммунные профили позволяют оценить тяжесть респираторно-синцитиального вирусного заболевания у детей раннего возраста. Sci. Пер. Med. 12 , eaaw0268 (2020).

    CAS PubMed PubMed Central Google Scholar

  • 11.

    Халл Дж., Томсон А. и Квятковски Д. Ассоциация респираторно-синцитиального вирусного бронхиолита с областью гена интерлейкина 8 в семьях Великобритании. Грудь 55 , 1023–1027 (2000).

    CAS PubMed PubMed Central Google Scholar

  • 12.

    Реш Б., Курат С. и Манцони П. Эпидемиология респираторно-синцитиальной вирусной инфекции у недоношенных детей. Open Microbiol. J. 5 , 135–143 (2011).

    PubMed PubMed Central Google Scholar

  • 13.

    Buckingham, S.C., Bush, A.J. и Devincenzo, J.P. Количество респираторно-синцитического вируса в носу коррелирует с тяжестью заболевания у госпитализированных младенцев. Pediatr. Заразить. Дис. J. 19 , 113–117 (2000).

    CAS PubMed Google Scholar

  • 14.

    Де Винченцо, Дж. П., Эль Салиби, К.M. & Bush, A.J. Респираторно-синцитиальная вирусная нагрузка позволяет прогнозировать тяжесть заболевания у ранее здоровых младенцев. J. Infect. Дис. 191 , 1861–1868 (2005).

    PubMed Google Scholar

  • 15.

    Fodha, I. et al. Респираторно-синцитиальные вирусные инфекции у госпитализированных младенцев: связь между вирусной нагрузкой, подгруппой вируса и тяжестью заболевания. J. Med. Virol. 79 , 1951–1958 (2007).

    CAS PubMed Google Scholar

  • 16.

    Garcia-Maurino, C. et al. Динамика вирусной нагрузки и тяжесть клинического заболевания у детей грудного возраста с респираторно-синцитиальной вирусной инфекцией. J. Infect. Дис. 219 , 1207–1215 (2019).

    CAS PubMed Google Scholar

  • 17.

    Hall, C. B. et al. Распространенность респираторно-синцитиального вируса группы A и B в течение 15 лет: связанные эпидемиологические и клинические характеристики у детей, находящихся в стационаре и амбулаторно. J. Infect. Дис. 162 , 1283–1290 (1990).

    CAS PubMed Google Scholar

  • 18.

    Hasegawa, K. et al. Геномная нагрузка респираторно-синцитиального вируса и тяжесть заболевания среди детей, госпитализированных с бронхиолитом: многоцентровые когортные исследования в США и Финляндии. J. Infect. Дис. 211 , 1550–1559 (2015).

    PubMed Google Scholar

  • 19.

    Thielen, B.K. et al. Летняя вспышка тяжелой болезни RSV-B, Миннесота, 2017 г., связанная с появлением генетически отличной вирусной линии. J. Infect. Дис. 222 , 288–297 (2020).

    CAS PubMed Google Scholar

  • 20.

    Пьедра, Ф. А. и др. Взаимозависимость вирусной нагрузки, врожденного иммунного ответа и клинического исхода у детей, поступающих в отделение неотложной помощи с респираторно-синцитиальным вирусным бронхиолитом. PLoS ONE 12 , e0172953 (2017).

    PubMed PubMed Central Google Scholar

  • 21.

    Tapia, K. et al. Дефектные вирусные геномы, возникающие in vivo, являются критическими сигналами опасности для запуска противовирусного иммунитета легких. PLoS Pathog. 9 , e1003703 (2013).

    PubMed PubMed Central Google Scholar

  • 22.

    Sun, Y. et al. Иммуностимулирующие дефектные вирусные геномы из респираторно-синцитиального вируса способствуют сильному врожденному противовирусному ответу во время инфекции у мышей и людей. PLoS Pathog. 11 , e1005122 (2015).

    PubMed PubMed Central Google Scholar

  • 23.

    Лаццарини Р. А., Кин Дж. Д. и Шуберт М. Происхождение дефектных интерферирующих частиц вирусов РНК с отрицательной цепью. Cell 26 , 145–154 (1981).

    CAS PubMed Google Scholar

  • 24.

    Лепперт, М., Корт, Л. и Колакофски, Д. Дальнейшая характеристика DI-РНК вируса Сендай: модель для их создания. Cell 12 , 539–552 (1977).

    CAS PubMed Google Scholar

  • 25.

    Perrault, J. в Initiation Signal in Viral Gene Expression (ed. Shatkin, A.J.) 151–207 (Springer, 1981).

  • 26.

    Хуанг А. С. и Балтимор Д. Дефектные вирусные частицы и процессы вирусных заболеваний. Nature 226 , 325–327 (1970).

    CAS PubMed Google Scholar

  • 27.

    Хенле В. и Хенле Г. Вмешательство неактивного вируса в распространение вируса гриппа. Наука 98 , 87–89 (1943).

    CAS PubMed Google Scholar

  • 28.

    Фон Мангус, П. Размножение штамма PR8 вируса гриппа А в куриных эмбрионах. II. Образование неполного вируса после инокуляции больших доз семенного вируса. Acta Pathol. Microbiol. Сканд. 28 , 278–293 (1951).

    Google Scholar

  • 29.

    Фон Магнус П. Неполные формы вируса гриппа. Adv. Virus Res. 2 , 59–79 (1954).

    Google Scholar

  • 30.

    Лопес, К. Б. Дефектные вирусные геномы: критические сигналы опасности вирусных инфекций. J. Virol. 88 , 8720–8723 (2014).

    PubMed PubMed Central Google Scholar

  • 31.

    Вебер М. и Вебер Ф. RIG-I-подобные рецепторы и вирусы с отрицательной цепью РНК: птица RLRly ловит некоторых червей. Cytokine Growth Factor Rev. 25 , 621–628 (2014).

    CAS PubMed PubMed Central Google Scholar

  • 32.

    Sun, Y. et al. Определенная последовательность в геноме респираторно-синцитиального вируса регулирует генерацию вирусных геномов, дефектных по обратному копированию. PLoS Pathog. 15 , e1007707 (2019).

    CAS PubMed PubMed Central Google Scholar

  • 33.

    Habibi, M. S. et al. Нарушение опосредованной антителами защиты и нарушение памяти B-клеток IgA при экспериментальном инфицировании взрослых респираторно-синцитиальным вирусом. г. J. Respir. Крит. Care Med. 191 , 1040–1049 (2015).

    CAS PubMed PubMed Central Google Scholar

  • 34.

    Vasilijevic, J. et al. Уменьшение накопления дефектных вирусных геномов способствует тяжелому исходу у пациентов, инфицированных вирусом гриппа. PLoS Pathog. 13 , e1006650 (2017).

    PubMed PubMed Central Google Scholar

  • 35.

    Ууситупа, Э., Варис, М., Хейккинен, Т. Связь вирусной нагрузки с тяжестью заболевания у амбулаторных детей с респираторно-синцитиальной вирусной инфекцией. J. Infect. Дис. 222 , 298–304 (2020).

    CAS PubMed Google Scholar

  • 36.

    Мартин, Э. Т., Кайперс, Дж., Вальд, А. и Энглунд, Дж. А. Множественные респираторные инфекции по сравнению с одним вирусом: вирусная нагрузка и клиническая тяжесть заболевания у госпитализированных детей. Influenza Other Respir. Вирусы 6 , 71–77 (2012).

    PubMed Google Scholar

  • 37.

    Franz, A. et al. Корреляция вирусной нагрузки респираторных патогенов и сопутствующих инфекций с тяжестью заболевания у детей, госпитализированных по поводу инфекции нижних дыхательных путей. J. Clin. Virol. 48 , 239–245 (2010).

    PubMed PubMed Central Google Scholar

  • 38.

    Янсен, Р. Р. и др. Количественное определение респираторных вирусов в зависимости от клинического течения у детей с острыми респираторными инфекциями. Pediatr. Заразить. Дис. J. 29 , 82–84 (2010).

    PubMed Google Scholar

  • 39.

    Shi, T. et al. Факторы риска респираторно-синцитиального вируса, связанного с острой инфекцией нижних дыхательных путей у детей в возрасте до пяти лет: систематический обзор и метаанализ. J. Glob. Здравоохранение 5 , 020416 (2015).

    PubMed PubMed Central Google Scholar

  • 40.

    van Elden, L.J. et al. Применимость количественного анализа ПЦР в реальном времени для диагностики респираторно-синцитиальной вирусной инфекции у взрослых с ослабленным иммунитетом. J. Clin. Microbiol. 41 , 4378–4381 (2003).

    PubMed PubMed Central Google Scholar

  • 41.

    Ларкин, Э. К. и др. Цели, дизайн и набор являются результатом восприимчивости младенцев к легочным инфекциям и астме после исследования воздействия RSV (INSPIRE). BMC Pulm. Med. 15 , 45 (2015).

    PubMed PubMed Central Google Scholar

  • 42.

    Родригес, Х., Хартерт, Т. В., Гебретсадик, Т., Кэрролл, К. Н. и Ларкин, Е. К. Простая оценка респираторной тяжести, которая может использоваться для оценки острой респираторной инфекции. BMC Res. Примечания 9 , 85 (2016).

    PubMed PubMed Central Google Scholar

  • 43.

    Jozwik, A. et al. RSV-специфические резидентные CD8 + Т-клетки дыхательных путей и дифференциальная тяжесть заболевания после экспериментального инфицирования человека. Nat. Commun. 6 , 10224 (2015).

    CAS PubMed PubMed Central Google Scholar

  • 44.

    Джексон, Г. Г., Доулинг, Х. Ф., Списман, И. Г. и Боанд, А. В. Передача простуды добровольцам в контролируемых условиях. I. Простуда как клиническое явление. Arch. Intern Med 101 , 267–278 (1958).

    CAS Google Scholar

  • 45.

    Perkins, S. M. et al. Сравнение анализа ПЦР с обратной транскриптазой в реальном времени и метода культивирования для количественной оценки вирусной нагрузки у детей, естественно инфицированных респираторно-синцитиальным вирусом. J. Clin. Microbiol. 43 , 2356–2362 (2005).

    CAS PubMed PubMed Central Google Scholar

  • 46.

    Rennard, S. I. et al. Оценка объема эпителиальной выстилки, извлеченной с помощью лаважа, с использованием мочевины в качестве маркера разведения. J. Appl. Physiol. (1985) 60 , 532–538 (1986).

    CAS Google Scholar

  • 47.

    Amorim, C.F. et al. Вариабельная экспрессия генов и паразитарная нагрузка позволяют прогнозировать исход лечения кожного лейшманиоза. Sci. Пер. Med. 11 , eaax4204 (2019).

    CAS PubMed PubMed Central Google Scholar

  • 48.

    Turi, K. N. et al. Младенческие вирусные респираторные инфекции назальный иммунный ответ и их связь с последующим повторяющимся хрипом в детстве. г. J. Respir.Крит. Care Med. 198 , 1064–1073 (2018).

    CAS PubMed PubMed Central Google Scholar

  • Глобальное молекулярное разнообразие RSV — исследование INFORM RSV | BMC Infectious Diseases

    Дизайн исследования

    INFORM RSV — это глобальное клиническое исследование, инициированное AstraZeneca в 2017 году для проспективного анализа штаммов RSV, полученных от детей младше 5 лет. Соавторы были идентифицированы через респираторно-синцитиальную вирусную сеть (ReSViNET; www.resvinet.org). ReSViNET Foundation — международная ведущая некоммерческая организация, стремящаяся снизить глобальное бремя инфекции RSV. В исследовании INFORM RSV положительные на RSV образцы из носа будут собираться у субъектов в рамках обычного клинического ухода в местных клинических центрах и отправляться в лабораторию Медицинского центра Университета Утрехта (UMCU), Нидерланды, для секвенирования и культивирования.

    В исследовании INFORM RSV цель состоит в сборе и секвенировании примерно 4000 респираторных образцов, положительных по RSV, в течение 5-летнего периода (2017–2022 гг.), Что соответствует 50 или 100 образцам на участок в год (дополнительные файлы, таблица 1 ).На момент написания, исследование INFORM RSV продолжалось 2 года и в настоящее время проводится в 17 странах на 18 участках (рис. 1). Мы стремимся распространиться на другие страны, где исследования бремени болезней продолжаются. Чтобы обеспечить как сезонное, так и географическое разнообразие, мы стремимся собирать 10–20 проб с каждого участка в месяц в течение ~ пятимесячного сезона RSV, который в среднем длится 5 месяцев. Если сайт может собрать больше, чем требуется, количество образцов, подмножество будет выбрано случайным образом.Секвенирование вирусного генома будет выполнено на всех образцах NGS с использованием амплифицированных кДНК с помощью RT-PCR в лаборатории UMCU. Для изучения молекулярной устойчивости подгруппа штаммов (~ 10%) будет случайным образом отобрана и культивирована для оценки функциональной чувствительности к разрабатываемым противовирусным препаратам и вирусной пригодности варианта RSV с изменениями сайта связывания лекарственного средства или доминирующими изменениями в немедикаментозном сайт привязки.

    Рис. 1

    Страны, участвующие в исследовании INFORM RSV. Красный — Старт в 2017 году; Синий — начало 2018 года; Желтый — начало 2019 года.Цифра была создана ACL с использованием Maptive (https://www.maptive.com)

    Участники исследования

    Дети имеют право участвовать в исследовании, если они соответствуют всем критериям включения (Таблица 1). Дети могут участвовать в исследовании, если они соответствуют всем следующим критериям: (1) младше 5 лет на момент отбора проб, (2) госпитализированы или посещены амбулаторно, (3) положительный результат теста на РСВ или подозрение на РСВ. иметь инфекцию RSV, когда тестирование RSV не является стандартной практикой.Подозрение на RSV определяется симптомами инфекции дыхательных путей (ИРО). В случаях, когда тестирование на RSV не является стандартом лечения, процедура информированного согласия выполняется перед сбором образцов для целей исследования. Нижние и верхние ИРО не дифференцируются. Подписанное и датированное письменное информированное согласие получено от родителя (ей) / законного представителя (ей) в соответствии с протоколом исследования INFORM RSV, Руководством Международной конференции по гармонизации надлежащей клинической практики E6 (ICH-GCP) и применимыми национальными и международными нормативными актами. требований, включая Хельсинкскую декларацию.Дети, которые соответствуют критериям исключения из использования профилактических или лечебных препаратов для RSV, например: паливизумаб, рибавирин или экспериментальное mAb против RSV или вакцина будут исключены из участия.

    Таблица 1 Критерии отбора для исследования INFORM RSV

    Сбор, хранение и отправка образцов

    После получения информированного согласия образцы из носоглотки собираются с помощью флокированных тампонов и помещаются в универсальную транспортную среду Copan (UTM). Когда пациенты проходят искусственную вентиляцию легких, бронхиальный аспират собирают в Copan UTM.Образцы хранятся локально при -80 ° C. Когда хранение — 80 ° C недоступно, образцы можно хранить при — 20 ° C перед отправкой в ​​лабораторию UMCU. Образцы предпочтительно хранить в оригинальном контейнере и маркировать уникальным штрих-кодом, предоставленным UMCU, соответствующим коду INFORM RSV. Образцы отправляются замороженными на сухом льду в лабораторию UMCU для секвенирования и культивирования после каждого сезона.

    Экстракция нуклеиновых кислот и подтип RSV

    Нуклеиновые кислоты экстрагируют из 250–500 мкл носовых образцов, положительных по RSV, с использованием набора MagNA Pure 96 DNA и Viral NA большого объема (Roche Diagnostics, Mannheim, Германия) в соответствии с инструкциями производителя.Нуклеиновые кислоты элюируют 50 мкл буфера для элюирования. Подтипирование и количественное определение RSV проводят с помощью мультиплексного анализа TaqMan RT-PCR гена RSV N с использованием смесей праймеров и зондов, специфичных для RSV-A и RSV-B. Реакции TaqMan RT-PCR проводят в системе StepOnePlus (Applied Biosystems) в общем объеме 10 мкл, включая 1 мкл нуклеиновых кислот, 1-шаговую мастер-смесь TaqMan Fast Virus (Thermo Fisher Scientific), прямой праймер RSV-A 900 нМ. (5 ′ AGATCAACTTCTGTCATCCAGCAA 3 ′), 900 нМ обратного праймера RSV-A (5 ′ TTCTGCACATCATAATTAGGAGTATCAAT 3 ′), 300 нМ RSV-B прямого праймера (5 ′ AAGATGCAAATCATAAATTATTCATTAGTAGGA 3 ′), обратного праймера 300GCTCCATAGGA 3 ′ ′), 58.3 нМ RSV-A зонд (5 ‘CACCATCCAACGGAGCACAGGAGAT 3’, 5’6-FAM / ZEN / 3’IBFQ) и 66,7 нМ RSV-B зонд (5 ‘TTCCCTTCCTAACCTGGACATAGCATATAACATACCT 3’, 5 ‘JOE NHS / ZEN / 3’ ) (Интегрированные ДНК-технологии). Условия цикла: 50 ° C в течение 2 минут и 95 ° C в течение 10 минут, затем 45 циклов при 95 ° C в течение 15 секунд и 60 ° C в течение 60 секунд.

    ОТ-ПЦР-амплификация геномов RSV и секвенирование следующего поколения

    При подтипе RSV соответствующие пары праймеров используются для обратной транскрипции и ПЦР-амплификации четырех перекрывающихся фрагментов генома RSV с использованием системы SuperScript IV One-Step RT-PCR ( Invitrogen, CA) в термоциклере 9800 Fast (Applied Biosystems).Четыре перекрывающихся фрагмента генома вместе составляют полный геном RSV, охватывающий все вирусные гены, но без дальних 3 ‘и 5’ концов генома. Вырожденные основания используются вместо генетически изменчивых оснований в штаммах RSV-A и RSV-B при необходимости (таблица 2). Условия цикла: 55 ° C в течение 10 минут и 98 ° C в течение 2 минут, затем 40 циклов при 98 ° C в течение 10 секунд, 61 ° C в течение 10 секунд и 72 ° C в течение 3 минут. Ампликоны проверяют на 1% агарозном геле, объединяют в эквимолярных количествах и очищают из 1% агарозного геля с использованием набора для очистки GeneJet PCR Purification Kit (Thermo Fisher Scientific).Затем очищенные ампликоны количественно определяют с помощью набора для анализа дцДНК Quant-iT PicoGreen (Thermo Fisher Scientific) в соответствии с инструкциями производителя. Затем нормализованные продукты ПЦР подвергаются конструированию библиотеки секвенирования следующего поколения (NGS) с использованием набора для подготовки библиотеки ДНК Nextera XT в соответствии с протоколом производителя (Illumina). Адаптеры секвенирования и штрих-коды Illumina добавляются к меченой ДНК посредством ПЦР-амплификации с использованием уникальных пользовательских олиго-последовательностей (Integrated DNA Technologies).Затем ДНК очищают и выбирают по размеру с использованием 0,6-кратного объема реагента Ampure XP (Beckman Coulter, Inc.) в соответствии с протоколом производителя. Затем очищенную ДНК количественно определяют с помощью набора для анализа дцДНК Quant-iT PicoGreen (Thermo Fisher Scientific) и смешивают в эквимолярных количествах. Секвенирование выполняется на платформе Illumina NextSeq500 (Illumina, Inc), генерируя считывания с парным концом 150 п.о.

    Таблица 2 Праймеры, использованные в этом исследовании для амплификации перекрывающихся фрагментов генома RSV

    Сборка и аннотация генома RSV

    Сборка считанных данных секвенирования в полные геномы выполняется с помощью AstraZeneca’s Next-Generation Sequencing Microbial Surveillance Toolbox (NGS-MSTB) — a полностью автоматизированный распределенный конвейер, реализованный с помощью Common Workflow Language (CWL) и с пользовательским интерфейсом на основе инструментальной среды биоинформатики Galaxy [12].Основным этапом обработки является целевая сборка de-novo с использованием Ariba [13] с индивидуальным протоколом сборки AstraZeneca, настроенным на надежность в присутствии смешанных вирусных субпопуляций и очень высокую вариабельность охвата. За этим следует пост-сборочная фильтрация малонаселенных плохо собранных квазивидов. Конвейер создает веб-отчет с показателями контроля качества и представлениями браузера генома на уровне контига и отдельного чтения. Рукопись с подробным описанием конвейера сборки и ее выпуска с открытым исходным кодом находится в стадии подготовки.

    Присвоение подтипов RSV выполняется в процессе сборки, а определение генотипов RSV выполняется путем филогенетической кластеризации с использованием справочной базы данных ранее описанных генотипов [14].

    Для определения полиморфизмов в областях связывания белка F в mAb RSV последовательности генов транслируют в аминокислотные последовательности, выравнивают с эталонными последовательностями (штаммы NL13) и регистрируют аминокислотные изменения.

    RSV культура

    Замороженные респираторные образцы, хранящиеся в UTM, размораживают, объединяют в соотношении 1: 1 с DMEM (минимальная необходимая среда Дульбекко; Lonza) с добавлением 5% FBS и 100 мкг / мл нормоцина (InvivoGen) и затем фильтруют через 0 .Фильтр 45 мкм. Фильтрат используют для заражения клеток HEp-2 (60% конфлюэнтности) в колбах T25 в течение 1 ч при 33 ° C и 5% CO2. Супернатант заменяют свежим DMEM с добавлением 5% FBS и 100 мкг / мл нормоцина и снова помещают в увлажненный инкубатор с 5% CO2 при 33 ° C. Вирусную культуру собирают при достижении приблизительно 70% цитопатического эффекта (ЦПЭ) центрифугированием при 247 × g в течение 10 мин и объединением супернатанта с 50% сахарозой в dPBS (стерильная фильтрация). Вирусы хранят в аликвотах по 1 мл при -80 ° C.

    Сбор и обработка данных

    Данные записываются в электронную форму отчетности образца (SRF) (Таблица 3). SFR со всех сайтов загружаются в центральную базу данных (eCASTOR) компанией Julius Clinical, после чего клинические данные объединяются с данными секвенирования. Для обеспечения анонимности субъекта будет введен только уникальный номер субъекта и возраст в месяцах. Данные будут заблокированы после каждого сезона.

    Таблица 3 Переменные пациента в электронной форме истории болезни

    Результаты

    Первичная конечная точка

    Последовательности RSV из глобальной популяции госпитализированных детей.

    Вторичные конечные точки
    1. 1.

      Общее количество подтипов RSV A и B и родственных геномов и связь этих подтипов с характеристиками пациентов (таблица 3)

    2. 2.

      Гомология гена F из циркулирующего RSV дикого типа с таковой у контрольных штаммов

    3. 3.

      Общее количество штаммов RSV с полиморфизмом в областях связывания mAb RSV или антигенных сайтах белка F RSV

    Расчет размера выборки

    Минимальное количество образцов, необходимое для этого исследования, составляет 2500. Размер выборки позволит получить точные оценки частоты подтипов RSV A и B, а также полиморфизмов. Ширина 95% доверительного интервала (ДИ) не превышает 4%.При крайне низкой или высокой распространенности (например, <7,5% или> 92,5%) ширина 95% доверительного интервала будет менее 2%. Это исследование также хорошо подходит для выявления различий в распространенности подтипов (RSV A и B). Оценка средней распространенности RSV A (две трети) была получена из исследования Zhu et al. [10]. Исследование INFORM RSV имеет не менее 90% мощности для выявления разницы в распространенности подтипов между группами 7% при альфа 0,05 (например, 70% RSV A у мужчин против 63% RSV A у женщин), и, по крайней мере, Мощность 90% для обнаружения эффекта размером 0.08 с использованием критерия хи-квадрат с 4 степенями свободы. Это означает, например, что это исследование может выявить разницу в распределении подтипов RSV, если распространенность RSV A по сайтам была приблизительно следующей: 58, 62, 66, 70 и 74%. Эти расчеты размера выборки проводились в программном обеспечении PASS с использованием двусторонних доверительных интервалов для одинарных пропорций с помощью простого асимптотического метода с поправкой на непрерывность и анализа мощности критерия хи-квадрат. Хотя 2500 образцов достаточно для обнаружения желаемого эффекта и, исходя из минимальной инвазивности для участников ИНФОРМ, исследование будет расширяться и включать больше стран для максимального понимания географического и временного разнообразия.

    Небольшие количества РНК респираторно-синцитиального вируса только в больших каплях вокруг младенцев, госпитализированных с острыми респираторными инфекциями | Устойчивость к противомикробным препаратам и инфекционный контроль

    Пациенты

    Исследование проводилось в течение трех зимних сезонов подряд (ноябрь 2017 г. — апрель 2020 г.) в педиатрическом отделении больницы Райнир де Грааф, Делфт, Нидерланды. В исследование были включены госпитализированные дети в возрасте от 0 до 2 лет с лабораторно подтвержденными инфекциями RSV-A или RSV-B.Однако в течение этих трех сезонов в исследовании выявлялись только пациенты с положительной реакцией на RSV-B. Пациенты были исключены, если они были старше 2 лет или если подписанное информированное согласие не было получено. По практическим соображениям пациенты с ослабленным иммунитетом и пациенты, которые испытывали симптомы более недели до госпитализации, не включались. Пациенты с другими сопутствующими заболеваниями, с сопутствующими вирусными инфекциями или принимавшие лекарства, в том числе противовирусные, не были исключены, но эта информация была задокументирована вместе с другими клиническими данными, полученными из медицинской карты пациента с использованием специально разработанной стандартизированной формы истории болезни. для этого исследования.Больные госпитализированы в одноместные палаты с дополнительной койкой для родителей. Во всех палатах была предусмотрена скорость вентиляции 2 воздухообмена в час (ACH) со скоростью транспортировки свежего воздуха 100 м 3 / час. Температура и относительная влажность регистрировались каждые пять минут в течение всего периода отбора проб воздуха с использованием регистраторов данных EL-GFX-2 (Lascar Electronics Inc.).

    Сбор образцов

    Для сбора RSV из воздуха использовался шестиступенчатый каскадный импактор Андерсена (Thermo Scientific ™) [18].Каскадный импактор работает со скоростью потока 28,3 л в минуту (LPM) и собирает капли и аэрозоли в зависимости от размера на шести различных стадиях: стадия 1 (> 7,0 мкм), стадия 2 (7,0–4,7 мкм), стадия 3 (4,7 мкм). –3,3 мкм), этап 4 (3,3–2,1 мкм), этап 5 (2,1–1,1 мкм) и этап 6 (1,1–0,65 мкм). Воздухозаборник каскадного импактора располагался примерно в 1 м от головы пациента на высоте 109 см. Пробы воздуха отбирали ежедневно в течение 30 минут, начиная со дня получения информированного согласия, до выписки или максимум в течение пяти дней.Чтобы предотвратить загрязнение образцов, отбор проб воздуха проводился утром перед обычным уходом, который может включать процедуры образования аэрозоля, такие как носоглоточная аспирация. Капли и аэрозоли ударялись по пластинам для сбора, заполненным полутвердым желатиновым слоем собственной разработки, как описано ранее [19]. Слой желатина получали из коммерческих желатиновых листов (10 мг / мл; доктор Эткер), растворенных в среде для переноса вирусов (VTM). VTM состояла из Minimum Essential Medium (MEM) — Eagle с Hank’s BSS и 25 мМ Hepes (Lonza), глицерина 99% (Sigma Aldrich), гидролизата лактальбумина (Sigma Aldrich), 10 MU полимиксина B сульфата (Sigma Aldrich), 5 MU нистатина. (Sigma Aldrich), 50 мг / мл гентамицина (Gibco) и 100 МЕ / мл пенициллина, 100 мкг / мл смеси стрептомицина (Lonza).Чтобы избежать высоких факторов разведения, каждую пластину для сбора сначала заполняли 32 мл 2% агарозы (Roche) в качестве нижнего слоя, на который пипеткой наносили 9 мл полутвердого желатина. Впоследствии чашки хранили при + 4 ° C не более 4 дней.

    В последний день отбора проб воздуха были взяты мазки с поверхности с использованием тампонов Copan flocked (Copan Diagnostics Inc.) из регистратора данных и направляющей кровати на той стороне, где располагался каскадный импактор. Начиная с первого дня отбора проб воздуха, назофарингеальные аспираты (для снятия заложенности) получали у пациентов во время плановой клинической помощи, если они были доступны, а в других случаях аспираты или мазки из носа отбирались специально для этого исследования, если согласие было дано родителями.От каждого родителя брали мазки из носа или горла (либо Copan eSwab®, либо Copan flocked тампоны (Copan Diagnostics Inc.)), когда это было возможно, в первый и последний день отбора проб воздуха, чтобы оценить их вклад в распространение вирусов в воздухе.

    Обработка образцов

    Пластины для сбора образцов с желатином из каскадного импактора обрабатывали после отбора образцов путем добавления 6 мл предварительно нагретого VTM с последующей 30-минутной инкубацией при 37 ° C для растворения слоя желатина и взятием образцов [19] .Мазки из носа и горла родителей собирали в Amies (eSwab®; Copan Diagnostics Inc.) или универсальной транспортной среде (UTM; флокированные мазки; Copan Diagnostics Inc.). VTM добавляли к носоглоточным аспиратам пациентов и образцам носа и горла родителей для достижения общего объема 6 мл, после чего носоглоточные аспираты центрифугировали при 500 G в течение 5 минут для удаления клеточного мусора. Затем все образцы были разделены на аликвоты и хранились при + 4 ° C не более 4 дней до дальнейшего анализа.Дополнительный флакон с каждым образцом хранили при -80 ° C. Поверхностные мазки собирали в UTM (флокированные мазки; Copan Diagnostics Inc.) и хранили в 25% сахарозе при -80 ° C. В конце исследования образцы размораживали и экстрагировали РНК с последующим анализом qRT-PCR.

    Клетки

    Клетки Hep-2 культивировали в среде Игла, модифицированной Дульбекко (DMEM, Lonza или Gibco), с добавлением 10% фетальной бычьей сыворотки (FBS) (Greiner или Atlanta Biologicals), 100 МЕ / мл пенициллина 100 мкг / мл стрептомицина смесь (Lonza), 200 мМ L-глутамин (Lonza), 1.5 мг / мл бикарбоната натрия (Lonza), 10 мМ HEPES (Lonza) и 0,25 мг / мл фунгизона (Invitrogen). Клетки поддерживали при 37 ° C и 5% CO 2 .

    Экстракция РНК и qRT-PCR

    РНК экстрагировали из образцов с помощью набора для выделения общей нуклеиновой кислоты MagNA Pure LC (Roche) и подвергали анализу qRT-PCR для обнаружения РНК RSV-B, а в случае пациенты с коинфекцией риновируса (РВ) также РНК РВ [20]. Для этого 20 мкл экстрагированной вирусной РНК амплифицировали в конечном объеме 30 мкл, содержащем 7,5 мкл 1-Step Master Mix 4xTaqMan Fast Virus (Life Technologies) и 1 мкл смеси праймер / зонд [20].Амплификацию проводили по следующему протоколу: 5 мин 50 ° C, 20 с. 95 ° C, 45 циклов по 3 с. 95 ° C и 31 с. 60 ° С. Для всех образцов значение порога цикла (Ct)> 40 считалось отрицательным.

    Титрование вируса

    RSV-B-положительных образцов титровали на клетках Hep-2 для количественного определения инфекционного вируса, как определено по культивируемости RSV. Вкратце, клетки Hep-2 выращивали до конфлюэнтности в 96-луночных планшетах в течение ночи. Затем клетки инокулировали центрифугированием (15 мин, 2000 об / мин) 100 мкл 10-кратных серийных разведений RSV-B-положительных образцов и инкубировали при 37 ° C, 5% CO 2 .Через час после инокуляции клетки промывали один раз и культивировали в модифицированной по Дульбекко среде Игла с пониженным содержанием сыворотки (2%) (DMEM, Lonza) с добавлением 100 МЕ / мл пенициллина, 100 мкг / мл смеси стрептомицина (Lonza), 200 мМ L-глутамина. (Lonza), 1,5 мг / мл бикарбоната натрия (Lonza), 10 мМ HEPES (Lonza) и 0,25 мг / мл фунгизона (Invitrogen). После 7 дней инкубации положительные образцы были идентифицированы с помощью иммунофлуоресцентного анализа с использованием поликлональных антител, меченных FITC, направленных против RSV (Fisher Scientific).Титры инфекционных вирусов рассчитывали из четырех повторов в виде инфекционной дозы тканевой культуры (TCID 50 ) по методу Спирмена-Карбера.

    Противовирусная эффективность ингибитора слияния респираторно-синцитиального вируса (RSV) на модели RSV-инфекции у крупного рогатого скота

    Abstract

    Респираторно-синцитиальный вирус (RSV) является основной причиной бронхиолита и пневмонии у младенцев. Эффективное лечение RSV-инфекции — серьезная неудовлетворенная медицинская потребность. Хотя в настоящее время разрабатываются новые терапевтические средства против RSV, существует очень мало животных моделей, которые имитируют патогенез человеческого RSV, что затрудняет оценку новых вмешательств при заболевании.Экспериментальное заражение телят голштинской породы бычьим RSV (bRSV) вызывает тяжелую респираторную инфекцию, аналогичную RSV-инфекции человека, что является подходящей моделью для тестирования новых терапевтических агентов. В этой модели вирусная нагрузка легко обнаруживается в назальном секрете с помощью количественной ПЦР в реальном времени (qRT-PCR), а совокупная оценка симптомов вместе с гистопатологическими оценками инфицированной ткани позволяет оценить тяжесть заболевания. Модель RSV крупного рогатого скота использовали для оценки противовирусной активности ингибитора слияния RSV, GS1, который блокирует проникновение вируса путем ингибирования слияния вирусной оболочки с мембраной клетки-хозяина.Эффективность GS1, близкого структурного аналога GS-5806, который разрабатывается для лечения RSV-инфекции у людей, оценивалась в двух рандомизированных слепых плацебо-контролируемых исследованиях на телах, инфицированных bRSV. Внутривенное введение GS1 в дозе 4 мг / кг массы тела / день в течение 7 дней, начиная с 24 часов или 72 часов после инокуляции, обеспечивало явный терапевтический эффект за счет снижения вирусной нагрузки, количества симптомов заболевания, частоты дыхания и патологии легких, связанных с инфекцией bRSV. Эти данные подтверждают использование модели RSV крупного рогатого скота для оценки экспериментальных терапевтических средств для лечения RSV.

    ВВЕДЕНИЕ

    Респираторно-синцитиальный вирус (RSV) является членом семейства Paramyxoviridae . RSV представляет собой оболочечный вирус с отрицательным геномом одноцепочечной РНК, который кодирует 11 белков, включая 3 поверхностных гликопротеина (F, G и SH) и 4 белка, которые составляют комплекс вирусной РНК-полимеразы (N, P, L и M2- 1). Вирус реплицируется в реснитчатых респираторных эпителиальных клетках, выстилающих дыхательные пути. Репликация вируса может вызывать синцитии (слияние клеток), которые легко наблюдаются в трансформированных клеточных линиях, а также обнаружены в тканях легких младенцев в смертельных случаях RSV-инфекции (1).Однако репликация RSV в первичных эпителиальных клетках дыхательных путей человека не вызывает измеримых цитопатических эффектов (2). Хотя прямые цитопатические эффекты, вызванные вирусом, могут не быть основной причиной клинического заболевания, репликация вируса активирует иммунные ответы хозяина, которые могут привести к иммуноопосредованному патогенезу (3).

    RSV циркулирует среди населения как единый серотип с двумя основными антигенными подгруппами, A и B, которые вызывают сезонные инфекции осенью и зимой в США и других регионах с умеренным климатом (4).Дети младше 2 лет, люди с ослабленным иммунитетом и взрослые с сопутствующей респираторной дисфункцией, такой как астма или хроническая обструктивная болезнь легких (ХОБЛ), подвергаются большему риску развития осложнений из-за RSV (5, –10). Хотя большинство инфекций проходит без медицинского вмешательства, инфекция RSV может вызывать острый бронхиолит и пневмонию у младенцев и пожилых людей (5, 11). Инфекция нижних дыхательных путей может вызвать тяжелую пневмонию, требующую госпитализации и приводящую к летальному исходу.

    Несмотря на обширное изучение клинических особенностей и иммунопатогенеза RSV, не существует эффективных терапевтических средств или вакцин для лечения RSV-инфекции. Профилактическое моноклональное антитело Synagis (паливизумаб) рекомендуется для предотвращения инфекции RSV среди младенцев с высоким риском инфицирования RSV нижних дыхательных путей (12). Стратегии вакцинации с использованием фиксированного формалином RSV в качестве иммуногена не полностью защищали младенцев от RSV-инфекции, а в некоторых случаях усиливали болезнь, что подчеркивает проблемы разработки эффективных детских вакцин против RSV (13).Единственным одобренным противовирусным средством для лечения RSV является виразол (рибавирин), который доставляется в виде ингаляционного агента. Виразол показал неоднозначную эффективность у пациентов с трансплантацией костного мозга и обычно не используется для лечения младенцев с RSV из-за плохой эффективности и переносимости, а также из-за сложности специальной системы доставки аэрозольных лекарств (14, –16). Ряд низкомолекулярных ингибиторов RSV был оценен как потенциальные терапевтические средства для лечения инфекций RSV, нацеленных на проникновение и репликацию вирусов (17, –23).В то время как несколько клинических кандидатов были оценены в исследованиях на людях, только рибавирин был одобрен для лечения инфекции RSV.

    Доклиническая разработка новых терапевтических средств требует оценки эффективности на животных моделях инфекции RSV. Модель хлопковых крыс обычно используется для измерения репликации RSV и оценки терапевтических средств RSV (24, 25). В то время как хлопковые крысы допускают заражение RSV, репликация вируса не вызывает количественных симптомов, и степень вирусной инфекции измеряется путем определения титров вируса в легких у инфицированных животных после эвтаназии.Таким образом, модель хлопковой крысы не подходит для измерения изменений в патогенезе заболевания в результате противовирусной терапии. Для изучения инфекции RSV были разработаны дополнительные животные модели с использованием шимпанзе, африканских зеленых мартышек, детенышей макак-резусов и мышей (18, 26, –29). Как и в модели с хлопковой крысой, репликация вируса не вызывает серьезного заболевания, и симптомы обычно незначительны или отсутствуют. Инфекция неонатальных ягнят RSV вызывает легкие симптомы, которые включают лихорадку, тахипноэ и недомогание, а также гистологические поражения легочной ткани (27, 30).Однако естественная история инфекции RSV в этой модели не была полностью охарактеризована, и имеются ограниченные данные о количественных измерениях вирусной нагрузки в тканях в ходе инфекции или о разработке методов количественной оценки симптомов для корреляции репликации вируса с прогрессированием заболевания. .

    RSV крупного рогатого скота (bRSV) — естественный патоген крупного рогатого скота, вызывающий у молодых животных заболевание, сходное с RSV человека (hRSV) (31, 32). Вирус реплицируется в верхних и нижних дыхательных путях, вызывая широкий спектр заболеваний, от субклинических до тяжелых бронхиолитов и пневмоний (33).Сходство в патогенезе между bRSV и hRSV подчеркивается исследованиями, которые продемонстрировали усиление заболевания с помощью инактивированной формалином вакцины bRSV / квасцы, полученной с использованием протокола, который создал усиливающую болезнь вакцину RSV, от которой в 1960-х годах заболели и погибли несколько детей (13, 34).

    Целью этого исследования было разработать доклиническую модель на животных для оценки эффективности экспериментальных терапевтических средств для лечения инфекции RSV человека. Чтобы проверить модель bRSV для тестирования противовирусных терапевтических вмешательств, мы проверили терапевтическую эффективность нового ингибитора слияния RSV GS1, близкого структурного аналога GS-5806, который, как недавно было показано, снижает вирусную нагрузку RSV и клинические симптомы на модели человека. экспериментальная инфекция RSV () (20).Влияние GS1 на репликацию bRSV и симптомы заболевания оценивали в двух рандомизированных плацебо-контролируемых слепых исследованиях эффективности у телят в возрасте до 8 недель для оценки эффективности GS1. Результаты демонстрируют, что инфекция bRSV молодых телят является подходящей моделью для количественной оценки воздействия антивирусного вмешательства на вирусную нагрузку и симптомы заболевания и может использоваться для оценки эффективности in vivo противовирусных соединений RSV.

    Конструкции GS1 и GS-5806.Я, метил.

    МАТЕРИАЛЫ И МЕТОДЫ

    Соединения.

    GS1 был синтезирован Департаментом медицинской химии Gilead Sciences (Фостер-Сити, Калифорния) ().

    Клетки и вирусы.

    Первичные клетки раковин крупного рогатого скота (BT) выращивали в среде Игла, модифицированной Дульбекко (DMEM) с добавлением 10% фетальной бычьей сыворотки (FBS), пенициллина (10 Ед / мл) и стрептомицина (100 мкг / мл) при 37 ° C. с 5% CO 2 . Первичные бычьи альвеолярные клетки типа 2 (BAT2) выделяли из легких новорожденного теленка, как описано ранее (35).Клетки выращивали в среде DMEM-кератиноцитов в соотношении 1: 1 (Invitrogen, Carlsbad, CA) с добавлением 2% FBS, 5 мМ l-глутамина, 0,02% лактальбуминдегидрогеназы и пенициллина (100 мкг / мл) -стрептомицина. (100 мкг / мл) (Invitrogen) при 37 ° C в увлажненном инкубаторе с 5% CO 2 .

    Запасы bRSV получали из клинического изолята вирулентного штамма bRSV (CA-1), как описано ранее (36, 37). Запасы вируса получали путем инфицирования монослоя клеток ВТ в колбе для культивирования Т75 3 × 10 5 БОЕ вируса.Инфицированные клетки инкубировали до тех пор, пока вирусные цитопатические эффекты (ЦПЭ) не достигли приблизительно 30-50% клеточного монослоя, обычно к 5 дню постинфекции. Культуры собирали и подвергали единственному циклу замораживания-оттаивания для высвобождения ассоциированного с клетками вируса. Аликвоты вирусных суспензий помещали на лед и вводили телятам в виде аэрозоля в течение приблизительно 1 часа. Дополнительные аликвоты использовали для количественного определения титра вируса с помощью анализа бляшек, и любой оставшийся вирус замораживали при -80 ° C.

    Противовирусная активность in vitro .

    Противовирусную активность GS1 против bRSV измеряли на клетках BT и BAT2 с использованием анализа жизнеспособности клеток, который измеряет клеточные уровни АТФ. Серийные трехкратные разведения GS1 готовили в диметилсульфоксиде (ДМСО) и добавляли в среду для культивирования клеток в 2-кратной конечной концентрации. Монослои клеток готовили в 96-луночных планшетах из расчета 1 × 10 4 клеток на лунку, и на следующий день их инфицировали bRSV при 0,05 БОЕ / клетку (множественность инфекции [MOI] 0,05) в конечном объеме 100 мкл.Приготовили параллельный набор планшетов и имитировали инфицирование для измерения цитотоксичности соединения. Планшеты для анализа инкубировали при 37 ° C в 5% CO 2 в течение 4 дней. Анализ был разработан путем удаления 100 мкл среды из каждой лунки с последующей инкубацией при комнатной температуре в вытяжном шкафу с ламинарным потоком, чтобы позволить планшетам уравновеситься. После уравновешивания в каждую лунку добавляли 100 мкл реагента Cell TiterGlo (Promega) и количественно определяли люминесценцию на 96-луночном считывающем устройстве для люминесцентных планшетов Victor.Отношение сигнал / фон составляло от 6 до 8 и рассчитывалось путем определения отношения сигнала люминесценции от неинфицированных клеток по сравнению с сигналом от инфицированных, необработанных клеток. Эффективную концентрацию соединения, которая ингибирует 50% вирус-индуцированных цитопатических эффектов (EC 50 ), вычисляли путем подгонки данных к уравнению логистической регрессии.

    Фармакокинетические исследования GS1 у телят.

    Фармакокинетические параметры плазмы для GS1 оценивали у телят-самцов голштинской породы в возрасте 12 недель и весом от 180 до 230 фунтов.Внутривенное (в / в) вливание проводилось через яремную вену медленным в / в. болюс в течение> 2 мин. Мазки из носа и образцы крови собирали до введения GS1 и после введения дозы через 0,08, 0,5, 1, 4 и 8 ч в день 1 и день 4.

    GS1 готовили в стерильной воде с 5% декстрозой (D5W), доведенной до pH. 3 с 1 н. HCl, стерильно профильтровали через фильтр 0,2 мкм и хранили в холодильнике в защищенном от света месте. Для дозы 2 мг / кг GS1 составляли из расчета 10 мг / мл и вводили в объеме дозы 0.2 мл / кг массы тела. Для дозы 4 мг / кг GS1 составляли из расчета 12 мг / мл и вводили в дозе 0,33 мл / кг.

    Образцы крови (примерно по 1 мл каждая) собирали в промаркированные пробирки Vacutainer, содержащие EDTA-K 3 в качестве антикоагулянта, и сразу же помещали на влажный лед. Образцы крови центрифугировали при 3000 × g , фракции плазмы переносили в отдельные пробирки, помеченные идентификатором животного (ID) и временем отбора проб, и немедленно замораживали при -80 ° C.

    Жидкость бронхоальвеолярного лаважа (ЖБАЛ) собирали у каждого животного через 1 и 24 часа после введения GS1. Бронхоальвеолярный лаваж проводили фосфатно-солевым буфером (PBS) при комнатной температуре тремя аликвотами общим объемом от 100 до 120 мл. Образцы BALF центрифугировали при 300 × g в течение 10 минут, супернатанты и осадок отделяли и замораживали при -80 ° C до анализа.

    Ткань легкого собирали при вскрытии трупа в конце фармакокинетического (PK) исследования.Образцы гомогенизировали в 1 мл PBS и хранили при -80 ° C до анализа.

    Анализ жидкостной хроматографии-масс-спектрометрии (ЖХ-МС).

    Система высокоэффективной жидкостной хроматографии (ВЭЖХ) состояла из колонки C 18 (50 × 3,0 мм) (колонка Hypersil Gold; Thermo Scientific, Сан-Хосе, Калифорния) (размер частиц 5 мкм), ВЭЖХ Agilent 1200 насос, автосамплер HTS PAL от LEAP Technologies (Каррборо, Северная Каролина) с тройным квадрупольным масс-спектрометром API-4000 (Applied Biosystems, Фостер-Сити, Калифорния), работающий в режиме мониторинга множественных реакций (с положительной ионизацией электрораспылением [ESI +], переход с 532.3 до 270,3, газовая завеса 25 л / мин, напряжение распыления 5 кВ, температура капилляров 600 ° C, энергия столкновения 53 В). Подвижная фаза A содержала воду с 0,1% муравьиной кислоты и 1% 2-пропанола. Подвижная фаза B содержала ацетонитрил с 0,1% муравьиной кислоты и 1% 2-пропанола. Градиент составлял от 5% до 95% подвижной фазы B за 3 мин, затем следовало 95% подвижной фазы B в течение 1 мин и время уравновешивания с 5% подвижной фазы B в течение 3 мин при скорости потока 0,5 мл / мин. Среднее извлечение GS1 из плазмы в диапазоне концентраций от 50 до 10 000 нг / мл составило 68%.Было обнаружено, что отклик детектора был линейным в диапазоне от 1 до 10 000 нМ. Предел обнаружения составил 2 нМ в плазме и BALF и 6 нМ в легочной ткани. Дневная и дневная точность образцов контроля качества (от 150 до 7500 нг / мл) варьировалась от 80 до 120%. Внутридневная и межсуточная точность образцов контроля качества (от 2 до 7500 нМ) варьировалась от 0,75% до 20%.

    Из-за переменного разбавления эпителиальной выстилки (ELF) и носовых выделений во время бронхоальвеолярного лаважа и промывания мазков из носа, маркер разведения использовался для определения концентрации GS1 в ELF и назального секрета из известных BALF и смывов мазков из носа. концентрация.Эндогенная мочевина использовалась в качестве маркера разведения. Для анализа были взяты аликвоты по 200 мкл 15 N 2 -меченой мочевины (внутренний стандарт) в смеси метанол-ацетонитрил-вода (25% / 25% / 50%, объем / объем / объем; 200 мкл). добавляли в BALF, мазок из носа и образцы плазмы (100 мкл), и образцы центрифугировали, сушили и восстанавливали в воде для анализа. Анализ выполняли с помощью системы ВЭЖХ, соединенной с тройным квадрупольным масс-спектрометром Micromass Quattro Premier с источником ESI +.Использовали колонку Aquasil C 18 (150 × 4,6 мм; 3 мкм) с мелким линейным градиентом вода-ацетонитрил с 0,2% муравьиной кислоты. Аналиты были обнаружены путем мониторинга выбранных переходов мониторинга реакции (SRM) ( m / z от 61 до 44 для мочевины и от 63 до 45 для 15 N 2 -меченой мочевины). Условия электрораспыления были следующими: напряжение конуса 25 В, температура источника 135 ° C и температура десольватации 435 ° C. Напряжения столкновения составляли 12 и 11 В для мочевины и 15 N 2 -меченой мочевины, соответственно.Было обнаружено, что отклик детектора для мочевины является линейным в диапазоне от 1 до 10 000 мкМ. Предел обнаружения составлял 2 мкМ в плазме BALF и смыве из носовых мазков. Дневная и дневная точность образцов контроля качества (от 150 до 7500 мкл) варьировалась от 80 до 120%. Внутридневная и межсуточная точность образцов контроля качества (от 2 до 7500 мкМ) варьировалась от 0,75% до 20%.

    Фармакокинетический анализ.

    Фармакокинетические параметры рассчитывали независимыми от модели методами с использованием WinNonlin (версия 5; SCI Software, Lexington, KY).Площадь под кривой «концентрация лекарственного средства-время» (AUC) и площадь под первым моментом кривой «концентрация лекарственного средства-время» (AUMC) были рассчитаны с помощью правила трапеции и экстраполированы на бесконечность (AUC от 0 ч до бесконечности [AUC 0 –∞ ] и AUMC от 0 ч до бесконечности [AUMC 0 – ∞ ]). Период полувыведения в β-фазе ( t 1 / 2β ) вычисляли, когда это было возможно, исходя из наклона конечной фазы логарифмических точек концентрации лекарственного средства в плазме крови с помощью линейной регрессии.Объем распределения в устойчивом состоянии ( V ss ) и системный клиренс (CL) определяли по следующим формулам: V ss = (внутривенная доза × AUMC 0 – ∞ ) / AUC 0 –∞ и CL = iv доза / AUC 0 – ∞ .

    Отбор крупного рогатого скота для исследования противовирусной эффективности.

    Протоколы исследования были одобрены Комитетом по уходу и использованию животных Калифорнийского университета в Дэвисе (UC Davis). Лечение животных придерживалось У.S. государственные принципы использования и ухода за позвоночными животными (38), Руководство по уходу и использованию лабораторных животных (39), Закон о благополучии животных (40) и другие применимые государственные законы и постановления. Телята-самцы были получены с местных молочных заводов и определены как отрицательные по bRSV с помощью анализа qRT-PCR образцов мазков из носа. Телята помещали в индивидуальные хозяйства в животноводческий комплекс Калифорнийского университета в Дэвисе и позволяли им акклиматизироваться в течение не менее 4-7 дней. За четыре дня до заражения всех телят в течение 3 дней подряд лечили дозой антибиотика цетиофур натрия Naxcel (1-2 мл / 100 фунтов массы тела) внутримышечно.Телят проверяли на наличие желудочно-кишечных паразитов и эктопаразитов. Телята также проверялись на сальмонеллу, если они поступали в животноводческий комплекс с симптомами диареи. Для исследования были отобраны только телят с температурой тела в пределах нормы, которые были отрицательными по bRSV и легкими, которые выслушивались в пределах нормы. Два катетера были вставлены в яремную вену у двух телят в каждой группе для дозирования и отбора проб PK, а один яремный катетер был вставлен в яремную вену только у телят в каждой группе для дозирования.Телят размещали индивидуально, чтобы избежать контакта, который мог бы нарушить установку катетера.

    Рандомизация.

    Телят взвесили, провели тест титра антител (титр непрямой иммунофлуоресценции [IFA]) (кровь взяли через 2 или 3 дня после прибытия) и рассчитали средний титр антител против bRSV. Примерно за 2 дня до заражения вирусом телят рандомизировали на группы так, чтобы средний титр антител и средняя масса тела были одинаковыми в каждой группе.Информация о дозировке для групп хранилась от группы исследователей на месте до завершения исследования (исследование проводилось вслепую).

    Посев на bRSV.

    Запасы вируса, амплифицированные на культурах клеток BT, использовали непосредственно для инокуляции. Приблизительно 5 мл распыленного bRSV в концентрации 2 × 10 4 БОЕ / мл вводили каждому теленку в течение 15-20 минут с использованием специально подобранной маски для лица, закрывающей нос и рот.

    Опытный образец.(i) Исследование 1.

    Восемь телят были рандомизированы в две группы (группы 1 и 2 по четыре теленка в каждой группе) на основании веса и титров антител против bRSV (). В день 0 животных инокулировали bRSV, как описано выше. В день 1 после инокуляции животным вводили GS1 в дозе 2 мг / кг (группа 1) или плацебо (группа 2) внутривенно. инъекция два раза в день (BID) в общей сложности 7 дней. Мазки из носа и образцы крови собирали ежедневно в течение 10 дней перед каждой дозой для измерения вирусной нагрузки и уровней лекарства, соответственно.На 7-й день после инокуляции были собраны образцы BALF для измерения вирусной нагрузки в легком. Физические осмотры проводились ежедневно на протяжении всего исследования для расчета баллов по клиническим симптомам. В конце исследования животных умерщвляли, и соответствующие ткани собирали для гистопатологической оценки.

    План эксперимента 1. Телята были рандомизированы на 2 группы в зависимости от веса и титров антител к bRSV. В день 0 животным инокулировали распыленный bRSV, доставляемый в дыхательные пути через лицевую маску, закрывающую нос и рот.Через 24 часа после инокуляции каждой группе животных вводили GS1 в дозе 2 мг / кг или плацебо путем внутривенной инъекции BID в течение всего 7 дней. Мазки из носа и образцы крови собирали ежедневно в течение 10 дней перед каждой дозой. На 7-й день после прививки отобранным животным проводили бронхиолярный лаваж. Физические осмотры проводились ежедневно на протяжении всего исследования для расчета баллов по клиническим симптомам. На 10-й день исследования животных умерщвляли, а ткани собирали для вскрытия трупа и гистопатологии.

    (ii) Исследование 2.

    Шестнадцать телят были включены в исследование и рандомизированы в 3 группы (группы 1, 2 и 3) на основании веса и титров антител против bRSV (). Два теленка в группе лечения 3 (плацебо) были исключены из исследования до инокуляции из-за возможного образования тромба и / или bRSV-положительного теста qRT-PCR. Остальным животным (всего 14) в день 0 был инокулирован bRSV. Один теленок был включен в исследование, но исключен из анализа из-за вторичной инфекции. Группе 1 (4 животных) вводили GS1 в дозе 4 мг / кг / день один раз в день, начиная с 1 дня и продолжая в течение 7 дней с последующим введением носителя в течение 2 дней.Одно животное в группе 1 получало лечение, но было исключено из анализа из-за развития вторичной бактериальной инфекции. Группе 2 (6 животных) вводили только носитель в течение 2 дней, начиная с 1-го дня, с последующим введением GS1 в дозе 4 мг / кг один раз в день в течение 7 дней, начиная с 3-го дня постинфекции. Группа 3 (4 животных) служила контрольной группой плацебо и получала 9 последовательных обработок носителем, начиная с первого дня. Образцы плазмы были собраны у 3 телят (2 из группы 1 и 1 из группы 3) в день 1 и у 3 телят (2 из группа 2 и 1 из группы 3) на 3 день для количественного определения уровней лекарственного средства.Приблизительно 1 мл крови собирали перед дозой и через 0,3, 0,5, 1, 4, 8 и 24 часа после введения. Мазки из носа и образцы крови для измерения вирусной нагрузки и концентрации лекарства собирали утром перед следующей дозой для каждого животного. Физические осмотры проводились ежедневно на протяжении всего исследования для расчета баллов по клиническим симптомам. В конце исследования животных умерщвляли, а ткани собирали для гистопатологической оценки.

    План эксперимента для исследования 2.Четырнадцать телят были инокулированы распыленным bRSV в день исследования 0. Группе 1 (4 животных) вводили GS1 в дозе 4 мг / кг / день один раз в день, начиная с 1 дня исследования и продолжая в течение 7 дней с последующим введением носителя в течение 2 дней. . Группе 2 (6 животных) вводили носитель в течение 2 дней, начиная с 1-го дня исследования, с последующим введением GS1 в дозе 4 мг / кг один раз в день в течение 7 дней, начиная с 3-го дня исследования. Группа 3 (4 животных) получала 9 последовательных доз. обработка транспортных средств, начиная с 1-го дня исследования.Образцы крови были взяты для выделения плазмы у 3 телят (2 из группы 1 и 1 из группы 3) в день исследования 1 и у 3 телят из дня исследования 3 (2 из группы 2 и 1 из группы 3) для количественного определения уровней лекарственного средства. Мазки из носа и образец крови брали утром перед введением дозы каждому животному для измерения вирусной нагрузки и концентрации лекарственного средства, соответственно. Физические осмотры проводились ежедневно на протяжении всего исследования для расчета баллов по клиническим симптомам. На 6 день исследования отобранным животным, у которых было достаточно хорошее состояние здоровья, был проведен бронхиальный лаваж.Животных умерщвляли на 10 или 11 день исследования, а ткани собирали для аутопсии и гистопатологии.

    Измерение вирусной нагрузки.

    Носовые мазки собирали путем введения стерильного ватного тампона в заднюю часть носовой полости, извлечения тампона и немедленного его помещения при перемешивании в 1 мл забуференного физиологического раствора Хенкса в стерильную пробирку с завинчивающейся крышкой на льду. Клетки назального эпителия собирали из этих назальных мазков и выделяли центрифугированием при 500 × g в течение 10 мин.Альвеолярные макрофаги легких выделяли из ЖБАЛ центрифугированием при 500 × g в течение 10 мин. Тотальную РНК выделяли из назального эпителия и альвеолярных макрофагов с помощью мини-набора RNeasy (Qiagen). Всего от 0,1 до 0,5 мкг РНК подвергали обратной транскрипции с использованием набора для обратной транскрипции высокой емкости (Applied Biosystems). qRT-PCR выполняли с использованием набора SYBR green master mix (Applied Biosystems) в системе ViiA-7 для ПЦР в реальном времени (RT-PCR) (Applied Biosystems). Амплификацию гена нуклеокапсида (N) bRSV использовали для мониторинга инфекции bRSV.Ген глицеральдегид-3-фосфатдегидрогеназы крупного рогатого скота (GAPDH) амплифицировали в качестве внутреннего контроля. Плазмиду со вставкой полноразмерного гена N bRSV и другую плазмиду с геном бычьего GAPDH использовали в качестве стандартов для расчета вирусных копий и копий GAPDH в проанализированных образцах РНК. Титр бычьего RSV был представлен как количество копий N-транскриптов на 10 5 копий транскриптов GAPDH.

    Оценка симптомов.

    Физические осмотры проводились до инфицирования (исходный уровень) и в каждый день исследования перед дозированием.Симптомы заболевания регистрировались вслепую и использовались для расчета баллов по симптомам заболевания. Этот метод ранее был подтвержден в многочисленных исследованиях (32, 34, 36). Оценка клинических симптомов была основана на совокупности наблюдений и измерений, которые включали температуру, частоту дыхания, признаки анорексии, конъюнктивита, выделения из глаз, выделения из носа, респираторный характер, одышку, дыхание через рот, кашель и аускультацию. Частоту дыхания измерял ветеринар (вслепую [не зная о группе лечения]) с помощью стетоскопа для подсчета вдохов в течение 1 минуты, отсчитывая время с секундной стрелкой на наручных часах.

    Патология легких.

    Телят гуманно усыпили с помощью внутривенной инъекции барбитурата. Были удалены верхние и нижние дыхательные пути и исследованы на предмет грубых повреждений. Гистопатологический анализ проводился вслепую сертифицированным ветеринарным патологом.

    Статистический анализ.

    Данные, собранные через 10 дней после заражения, были включены в анализ. Теленок 908 (группа 1) был исключен из анализов в исследовании 2 из-за вторичной бактериальной инфекции.Площадь под кривой рассчитывалась для каждого теленка для логарифма вирусной нагрузки 10 , оценки клинических симптомов и конечных точек частоты дыхания в каждом исследовании. Перед преобразованием log 10 к каждому измерению добавлялось значение 1, чтобы предотвратить ошибки, вызванные преобразованием log 10 нулевых значений. AUC log 10 вирусной нагрузки оценивали с помощью теста суммы рангов Вилкоксона (двусторонний тест) (значение P <0,05 считалось статистически значимым) в исследовании 1.Все остальные конечные точки оценивались с помощью модели рангового анализа ковариации (ANCOVA) (двусторонний тест) (значение P <0,05 считалось статистически значимым) с исходным уровнем в качестве ковариаты для учета различных исходных значений.

    РЕЗУЛЬТАТЫ

    In vitro противовирусная активность GS1 против bRSV.

    GS1 представляет собой новый низкомолекулярный ингибитор RSV, который нацелен на белок F RSV и предотвращает проникновение вируса в клетку-хозяин, ингибируя слияние вирусной оболочки с мембраной клетки-хозяина.Соединение является мощным ингибитором человеческого RSV in vitro (среднее EC 50 = 0,3 ± 0,1 нМ), но неактивно против других парамиксовирусов, таких как метапневмовирус человека, вирус парагриппа и генипавирусы (данные не показаны). Белок F RSV из bRSV на 82% идентичен белку F hRSV на 82%, а аминокислотные остатки, которые, как известно, придают лекарственную устойчивость к ингибиторам слияния в hRSV, консервативны на 100%. Чтобы определить, был ли GS1 активен против bRSV, соединение оценивали на противовирусную активность в бычьих раковинах (BT) и бычьих альвеолярных клетках типа 2 (BAT2).Среднее значение EC 50 с для GS1 в клетках BT и клетках BAT2, инфицированных bRSV, составляло 0,36 ± 0,1 нМ ( n = 4) и 0,39 ± 0,3 нМ ( n = 4), соответственно (), эффективность соответствует с тем, что наблюдалось против hRSV. GS1 не был цитотоксичным в клеточных линиях, используемых для противовирусного тестирования, при самых высоких протестированных концентрациях (25 мкМ).

    ТАБЛИЦА 1

    Противовирусная активность GS1 для bRSV a

    50 b (мкМ) ( n = 4)
    Вирус Тип клеток EC 50 (нМ) (SD) ( n 75 = 4) CC
    bRSV BT 0.36 (0,10) > 25
    BAT2 0,39 (0,30) > 25
    hRSV HEp-2 0,30 (0,10) c

    5

    Фармакокинетический профиль многократного введения GS1 у телят.

    Фармакокинетические профили многократного введения GS1 были измерены у телят-самцов голштинской породы для определения безопасности, переносимости и воздействия GS1 в плазме и дыхательных путях ().Эти данные были использованы для определения оптимального уровня дозы и частоты дозирования для последующих исследований эффективности. Стабильность GS1 была сходной в анализах микросом печени крупного рогатого скота и человека in vitro . Кроме того, GS1 показал немного более высокое связывание с белками плазмы в плазме крупного рогатого скота, чем в плазме человека (99,6% против 97,1%, соответственно). Двенадцатинедельным телятам вводили GS1 в виде повторного внутривенного введения. инъекции по 4 мг / кг / день в течение 4 дней подряд. Образцы крови собирали в выбранные моменты времени, и из образцов крови выделяли плазму для измерения концентраций соединения.Образцы мазков из носа собирали одновременно с образцами крови, образцы BALF собирали через 1 и 24 часа после введения соединения, а легочную ткань собирали через 24 часа после последней дозы при вскрытии для измерения концентраций соединения.

    ТАБЛИЦА 2

    Фармакокинетические свойства GS1 у телят после 4-дневного внутривенного введения один раз в день. болюсное введение (4 мг / кг)

    6
    Параметр PK a (единицы) Среднее значение (диапазон) b на:
    День 1 День 4
    AUC 0 — последний (нМ · ч) 14,649 (9,723–19,575) 23,251 (12,433–34,069)
    CL (л / ч / кг) 0.58 (0,37–0,78) 0,39 (0,17–0,61)
    V SS (литр / кг) 3,7 (3,1–4,3) 3,1 (3,2–3,0)
    MRT INF (в) 6,8 (5,5–8,2) 11,3 (5,2–17,5)
    т 1 / 2β (в) 6,0 (4,8–7,3) 9,0 (4,9 –13,2)
    C макс. (нМ) 3,180 (2,270–4,090) 2,880 (2180–3,580)
    C 8

    (
    ) (нМ) –921) 1,154 (358–1,950)
    C 24 (нМ) 123 (44–201) 340 (55–624)

    После повторения 4 мг / кг доз GS1, период полураспада GS1 в плазме составлял 6 часов и 9 часов в день 1 и 4, соответственно.Площадь под кривой концентрация-время в течение 24-часового интервала дозирования (AUC 0 — последние ) составляла 15 494 нМ · ч в день 1 (диапазон от 9 723 до 19 575 нМ · ч) и 23 251 нМ · ч (диапазон 12 433 нМ · ч). до 34 069 нМ · ч) на 4-й день. Данные свидетельствуют об увеличении системного воздействия GS1 после многократных доз 4 мг / кг / день. Однако следует отметить, что только небольшое количество животных ( n = 2 на момент времени) было включено в фармакокинетический анализ; следовательно, различия не могли быть оценены статистически.Примечательно, что GS1, по-видимому, распределяется в легочной ткани. В виде отдельной однократной дозы в / в. исследования, концентрация GS1 в легочной ткани была в 145 раз выше, чем концентрация в плазме (). Более того, концентрация GS1 была заметно выше в образцах ЖБАЛ (в 15 раз) и мазках из носа (в 4 раза), чем в образцах плазмы (). Эти данные указывают на преимущественное распределение GS1 в терапевтически релевантных компартментах и ​​тканях.

    ТАБЛИЦА 3

    Концентрации лекарственного средства в различных компартментах через 24 ч после введения GS1 (4 мг / кг i.v. болюс) для здоровых телят

    Плазма 908 908 908 908 908 902 908 В соответствии с фармакокинетическим профилем доза 4 мг / кг / день была выбрана для последующих оценок эффективности, чтобы гарантировать адекватное воздействие соединения для противовирусной эффективности.

    Терапевтическая эффективность GS1, вводимого два раза в день (BID).

    Эффективность GS1 оценивалась в рандомизированных плацебо-контролируемых слепых исследованиях для устранения потенциальной систематической ошибки, связанной с оценкой симптомов и измерениями эффективности (). В первом исследовании (исследование 1) оценивалось двухразовое введение GS1 в дозе 2 мг / кг / доза, начатая через 24 часа после инокуляции bRSV. В исследовании участвовали 8 телят, которые были рандомизированы в группы, получавшие GS1 (группа 1 [ n = 4]) или плацебо (группа 2 [ n = 4]).Каждый день каждого животного проводился физический осмотр и регистрировались симптомы инфекции bRSV. Ежедневно собирали образцы смыва из носа для измерения вирусной нагрузки и уровней лекарственного средства. На 6-й день после инфицирования были получены образцы лаважа легких для анализа вирусной нагрузки в жидкости лаважа легких. На 11 день животных умерщвляли и собирали ткани для гистопатологии.

    Все инокулированные телята заразились bRSV, что было определено с помощью положительных значений qRT-PCR из образцов смыва из носа. У большинства животных на 2-й день после прививки наблюдались клинические признаки инфекции, основанные на оценке симптомов.У телят, получавших плацебо, вирусная нагрузка и оценка симптомов увеличивались по мере развития инфекции и достигли пика между 6 и 8 днями после прививки, после чего следовало снижение до конца исследования (). Частота дыхания увеличилась в ходе исследования, хотя вирусная нагрузка и количество симптомов снизились.

    Средние вирусные нагрузки, оценка симптомов и частота дыхания телят в исследовании 1. Вирусные нагрузки были количественно определены на основе мазков из носа с помощью qRT-PCR, а значения РНК bRSV были нормализованы к значениям клеточной мРНК GADPH.Суммарная оценка симптомов и частота дыхания рассчитывались на основе ежедневных физических осмотров каждого животного. Средние значения вирусной нагрузки и каждой оценки ( n = 4 на группу) нанесены на график как функция времени после инокуляции, а положительные полосы ошибок представляют собой стандартные ошибки средних значений.

    Телята, получавшие GS1 дважды в день, имели пониженную вирусную нагрузку в образцах смыва из носа, более низкие показатели симптомов и более низкую частоту дыхания по сравнению с животными, получавшими плацебо (и; см. Таблицу S1 в дополнительном материале).Средние значения AUC кривой вирусной нагрузки для животных, получавших GS1, и животных, получавших плацебо, составляли 5,9 и 18,9 log 10 эквивалентов bRSV / GAPDH · день / мл ( P = 0,061), соответственно. Средние значения AUC для оценки симптомов у животных, получавших GS1, и животных, получавших плацебо, составляли 366,3 и 1 912,4 балла в день ( P = 0,018), соответственно. Также было отмечено снижение частоты дыхания у обработанных животных по сравнению с животными, получавшими плацебо (293,0 против 508,6 вдохов в день / мин ( P = 0.027).

    ТАБЛИЦА 4

    Вирусная нагрузка, оценка симптомов и частота дыхания у телят, инфицированных bRSV, получавших GS1 или плацебо BID (исследование 1)

    Отсек или образец Концентрация GS1 (мкМ) за 24 часа a Отношение к плазме b
    1.0
    Носовой тампон 78 c 4.0
    BALF 88 15
    15
    Параметр (единицы) Среднее значение a (SD) для группы, получавшей:
    P значение
    GS1 ( n = 4) носитель ( n = 4)
    AUC log 10 вирусная нагрузка (log 10 геномных эквивалентов · день / мл) 5.9 (3,3) 18,9 (7,2) 0,061 b
    AUC оценки симптома (балл в день) 366,3 (278,1) 1,912,4 (1,172,5) 0,018 c
    AUC частоты дыхания (количество вдохов в день / мин) 293,0 (35,1) 508,6 (144,7) 0,027 c

    Патологии легких оценен.Между группой, получавшей плацебо, и группой, получавшей GS1, наблюдались четкие различия в отношении процента консолидации легких и наличия типичных поражений bRSV (см. Таблицу S3 в дополнительном материале). Средний процент консолидации легких у телят, получавших плацебо, составил 33,8% по сравнению с 0% для телят, получавших GS1. Консолидацию легкого патологоанатом оценил путем расчета процента консолидации для каждой доли и общей консолидации легкого.Бронхоинтерстициальная пневмония была обычным явлением у инфицированных телят, получавших плацебо, но не наблюдалась у животных, получавших GS1. У телят, получавших плацебо, также были признаки облитерирующего бронхиолита и гиперплазии эпителиальных клеток типа II, а у нескольких телят в срезах легких присутствовали синцитиальные клетки. У трех из четырех телят, получавших плацебо, был обнаружен bRSV в срезах легких с помощью иммуногистохимии, в то время как, напротив, ни у одного из телят, получавших GS1, антиген bRSV не был обнаружен в срезах легких.В совокупности эти результаты демонстрируют, что введение GS1 BID, начатое через 24 часа после инокуляции, снижает репликацию вируса и клинические симптомы, а также патологию заболевания, связанную с инфекцией bRSV.

    Ткань легких телят в исследовании 1, получавших GS1 или плацебо. У теленка 1-3 (теленок 3 из группы 1) (получавших GS1) не было выявлено грубых повреждений с 0% консолидацией легких, за исключением очагового фиброзного спайки на грудной стенке. Кроме того, имелся мягкий нейтрофильный бронхиальный экссудат с редкими лимфоидными агрегатами в бронхиальном и бронхиолярном эпителии, и не было активной бронхопневмонии или экссудации в легких.При иммунном окрашивании легочной ткани никаких доказательств bRSV обнаружено не было. Напротив, у теленка 2–3 (теленок 3 из группы 2) (лечившегося плацебо) наблюдалась 60% консолидация легких и широко распространенная бронхоинтерстициальная пневмония с нейтрофильной экссудацией, при которой бронхиолы имели гиперпластический эпителий с очаговым некрозом и окружающим лимфоплазмоцитарным инфильтратом. Наблюдались мультифокальные эпителиальные синцитии и синцитии в альвеолярных пространствах. Иммунное окрашивание показало bRSV-положительный сигнал в легочной ткани. Описание результатов гистопатологии для отдельных животных показано в таблице S3 в дополнительном материале.

    Терапевтическая эффективность GS1, вводимого QD.

    После демонстрации эффективности дозирования GS1 BID было проведено второе рандомизированное плацебо-контролируемое исследование для оценки эффективности соединения, вводимого один раз в день (QD). Кроме того, это исследование также было разработано для сравнения эффективности раннего и отсроченного начала лечения GS1. Четырнадцать телят-самцов в возрасте от 4 до 6 недель были рандомизированы в три группы и инфицированы bRSV. Телятам вводили GS1 в дозе 4 мг / кг один раз в день через 24 часа (группа 1) или 72 часа (группа 2) после инокуляции bRSV или лечили плацебо (группа 3;).Лечение проводилось в течение 7 дней, и вирусная нагрузка измерялась с помощью мазков из носа, взятых ежедневно, и образцов BALF, взятых на 6 день после инокуляции и в конце исследования. Баллы клинических симптомов оценивались ежедневно, как описано для исследования 1.

    Начало лечения в день 1 и день 3 с QD введения 4 мг / кг GS1 телятам, инфицированным bRSV, снижало вирусную нагрузку, а также сравнивали баллы клинических симптомов и частоту дыхания. к лечению плацебо (а). Однако величина противовирусных эффектов была выше у животных, которые получили раннее лечение в 1 день после прививки.Лечение GS1, начатое в день 1 и день 3, снизило среднюю AUC вирусной нагрузки на 94% и 50% соответственно по сравнению со значениями для лечения плацебо (AUC 8,6, 18,8 и 21,6 log 10 bRSV / GAPDH эквиваленты · день / мл для начала лечения в день 1, начала лечения в день 3 и лечения плацебо, соответственно) (см. Таблицу S2 в дополнительном материале). Аналогичные тенденции наблюдались для снижения AUC оценок клинических симптомов и частоты дыхания в группах, получавших GS1, по сравнению с группой, получавшей плацебо (; данные по отдельным животным в таблице S2 в дополнительном материале).

    Средние вирусные нагрузки, оценка симптомов и частота дыхания телят в исследовании 2. Вирусные нагрузки были количественно определены на основе мазков из носа с помощью qRT-PCR, а значения РНК bRSV были нормализованы по клеточной мРНК GADPH. Суммарная оценка симптомов и частота дыхания рассчитывались на основании ежедневных физических осмотров каждого животного. Средние значения для телят, получавших плацебо ( n = 3) и телят, получавших GS1 в день 1 лечения ( n = 4) (белые кружки) или на 3 день лечения ( n = 6) (серый кружки) построены как функция времени после заражения (стр.i.), а столбцы положительных ошибок представляют собой стандартные ошибки средних значений.

    ТАБЛИЦА 5

    Вирусная нагрузка, оценка симптомов и частота дыхания у крупного рогатого скота, инфицированного bRSV, получавшего QD GS1 или плацебо (исследование 2)

    643,7 1150,8 (
    Параметр (единицы) Среднее значение (SD) для группы, получавшей a :
    P значение c
    GS1
    Автомобиль ( n = 4)
    Раннее ( n b) С задержкой ( n = 6)
    AUC log 10 вирусная нагрузка (log 10 эквивалентов генома · день / мл) 8.6 (8,0) 18,8 (8,1) 21,6 (12,3) 0,33
    AUC оценки симптома (балл в день) 657,7 (182,6) 606,4 (297,3) 0,18
    AUC частоты дыхания (кол-во вдохов · день / мин) 221,0 (17,1) 262,7 (60,6) 319,5 (110,4) 0,22
    Разница в легких патологии были выявлены у животных, получавших GS1 и плацебо.Средние значения процента консолидации легких составляли 7,5 и 9,4 у животных из групп раннего и отсроченного лечения, соответственно, по сравнению с 22,4 консолидацией, наблюдаемой у животных из группы, получавшей плацебо. В то время как оценка поражений легочной ткани была несколько осложнена присутствием распространенного патогена легких крупного рогатого скота Mycoplasma bovis , бронхиолит и бронхоинтерстициальная пневмония, связанные с инфекцией bRSV, наблюдались в основном у телят, получавших плацебо (см. Таблицу S4 в дополнительный материал).

    Ткань легких телят в исследовании 2, получавших GS1 или плацебо. Ткань легких теленка 1-2 (теленок 2 из группы 1) из основной группы 1 (лечение GS1 через 24 часа после инфицирования) показала минимальный мультифокальный мультилобулярный ателектаз (<1% массы легкого) и легкую двустороннюю нейтрофильную гистиоцитарную бронхопневмонию. Mycoplasma bovis был выделен из ткани, но антиген bRSV не был обнаружен иммуноокрашиванием. Ткань легкого теленка 2-6 (теленок 6 из группы 2) из ​​исследуемой группы 2 (лечение GS1 через 72 часа после инфицирования) показала минимальную фокальную многодолевую консолидацию в правой средней доле (<1% массы легкого) с региональным фокальным мультилобулярным ателектазом с минимальная гистиоцитарная нейтрофильная бронхопневмония. Mycoplasma bovis была выделена из легочной ткани, но при иммунном окрашивании оказалась отрицательной на bRSV. Ткань легкого теленка 3–3 (теленок 3 из группы 3) из исследуемой группы 3 (животное, получавшее плацебо) показала тяжелую двустороннюю антеровентральную легочную консолидацию (от 45 до 50% массы легкого). В пораженных долях легкого были обнаружены обширные мультилобулярные участки нейтрофильной бронхопневмонии с мультифокальным некрозно-гнойным бронхиолитом и очаговым некрозом. Arcanobacterium pyogenes и Mycoplasma bovis были выделены из легочной ткани, но bRSV не был обнаружен иммунным окрашиванием.Описание результатов гистопатологии для отдельных животных показано в таблице S4 в дополнительном материале.

    ОБСУЖДЕНИЕ

    Инфекция RSV может привести к серьезным респираторным заболеваниям у детей, пожилых людей и пациентов с ослабленным иммунитетом из группы высокого риска. В настоящее время не существует эффективных противовирусных средств для лечения RSV-инфекции в этих группах пациентов с высоким риском. Одним из ограничений разработки новых клинически эффективных противовирусных методов лечения является отсутствие животных моделей инфекции RSV с подтвержденными клиническими конечными точками, которые отражают патогенез инфекции человека.Экспериментальное заражение телят голштинской породы bRSV вызывает респираторное заболевание с аналогичной вирусной динамикой, патологией и клиническими симптомами, что и у педиатрической инфекции RSV человека, что делает эту систему-кандидат модельной для изучения эффективности противовирусных терапевтических средств.

    Во время инфицирования bRSV количественную оценку вирусной нагрузки можно проводить с помощью qRT-PCR с использованием внутреннего гена хозяина (GADPH) в качестве стандарта для нормализации общего количества введенной РНК, тем самым снижая вариабельность, связанную с отбором образцов.Оптимизированная процедура мазка из носа максимизирует извлечение эпителиальных клеток носа, которые содержат значительное количество вируса по сравнению с вирусом, обнаруженным в слизистом слое. Количественная оценка вирусной нагрузки в выделениях из носа и жидкостях лаважа легких инфицированных животных в ходе инфекции выявила пиковые титры вируса между 6 и 8 днями после инокуляции с последующим снижением вирусной нагрузки.

    У телят, зараженных bRSV, в течение 3 дней после прививки развиваются респираторные симптомы, пик которых наступает через 6–9 дней после прививки, после чего наблюдается снижение симптомов до исчезновения инфекции (32).Симптомы включают гиперсекрецию слизистой, спонтанный кашель, эпизодические хрипы, одышку и учащенное дыхание с высокой вирусной нагрузкой, обнаруживаемой в выделениях из носа и в образцах ЖБАЛ. Составная оценка симптомов — эффективный метод количественной оценки наблюдений, проводимых во время физических осмотров (41, 42). Составная система баллов, использованная в этом исследовании, была разработана для количественной оценки наблюдаемых физических симптомов, связанных с тяжестью заболевания. Чтобы снизить вероятность экспериментальной ошибки, вносимой субъективной оценкой, все исследования клинических симптомов проводились слепым методом независимым экспертом.Хотя существует общая корреляция между вирусной нагрузкой в ​​выделениях из носа и наблюдаемой серьезностью симптомов, оценка симптомов могла быть затруднена наличием вторичной легочной инфекции, вызванной другими патогенами крупного рогатого скота, такими как Mycoplasma bovis . У большинства животных с этим можно успешно справиться путем кондиционирования животных антибиотиками до их включения в исследования эффективности. Гистопатологическая оценка легочной ткани при вскрытии отражает оценки симптомов с признаками консолидации легких, вирус-индуцированной синцитии, бронхиолита и интерстициальной пневмонии у нелеченных животных, инфицированных bRSV (см. Таблицы S3 и S4 в дополнительном материале).

    В целом, способность объективно количественно определять вирусную нагрузку, количество симптомов, респираторные параметры и патологию легких указывает на то, что инфицированные bRSV телята представляют собой надежную модель для проверки эффективности in vivo новых терапевтических средств RSV. Это контрастирует с другими моделями RSV, которые обычно используются для оценки методов лечения RSV, которые не моделируют адекватно патогенез инфекции.

    Пригодность модели инфекции bRSV для оценки противовирусных препаратов была подтверждена с использованием GS1, нового низкомолекулярного ингибитора с сильной активностью in vitro против как bRSV, так и hRSV.GS1 является близким структурным аналогом GS-5806, который в настоящее время находится в стадии клинической разработки для лечения инфекции RSV (43). GS-5806 был протестирован на здоровых взрослых людях, экспериментально инфицированных клиническим штаммом RSV (20). Пероральное введение GS-5806 было начато после подтверждения инфекции RSV с помощью ПЦР-анализа образцов смыва из носа и продолжалось в течение 5 дней. Различные схемы лечения GS-5806, включая введение однократной дозы, снижали вирусную нагрузку в выделениях из носа, массу слизистой оболочки и показатели клинических симптомов.

    В соответствии с фармакокинетическими параметрами, прогнозирующими противовирусную эффективность, введение GS1 один или два раза в день в течение 7 дней животным, инфицированным bRSV, снижало вирусную нагрузку и количество симптомов заболевания по сравнению с животными, получавшими плацебо. Кроме того, животные, получавшие GS1, показали улучшенную функцию дыхания, при этом частота дыхания приближалась к исходному уровню. В то время как лечение BID, начатое через 24 часа после прививки, оказало наиболее сильное влияние на вирусную нагрузку, количество симптомов и патологию легких, отсроченное введение QD, начатое через 72 часа после прививки, также показало доказательство противовирусной эффективности.Исследование легочной ткани при аутопсии продемонстрировало четкие различия в гистопатологии между животными, получавшими GS1 и плацебо, даже у животных, которые получали лекарственную терапию через 72 часа после инокуляции (см. Таблицу S4 в дополнительном материале). У животных, получавших лекарственные препараты, наблюдалась пониженная консолидация легких и минимальные признаки бронхиолита и пневмонии. Эти результаты показывают, что репликация вируса в дыхательных путях инфицированных телят вызывает болезнь и что ингибирование репликации вируса с помощью GS1 обеспечивает клиническую пользу.Важно отметить, что все режимы дозирования GS1 оказались безопасными и хорошо переносились лечившимися телятами голштинской породы.

    Настоящая модель инфекции bRSV основана на аэрозольной доставке вируса через нос, которая обеспечивает инфицирование как верхних, так и нижних дыхательных путей у всех привитых животных. В то время как большинство инфекций RSV человека начинаются в верхних дыхательных путях и вызывают легкое заболевание с симптомами простуды, которые проходят без необходимости медицинского вмешательства, у некоторых лиц с высоким риском, включая относительно большую часть педиатрической популяции, инфекция будет распространяться. в нижние дыхательные пути.Инфекции нижних дыхательных путей обычно приводят к более тяжелому заболеванию и являются наиболее частой причиной бронхиолита и пневмонии, связанных с РСВ, которые часто требуют госпитализации. В соответствии с заболеванием человека, патология легких у телят, инфицированных bRSV, показала признаки бронхиолита и пневмонии, выраженные у животных, получавших плацебо, что указывает на то, что репликация bRSV в нижних дыхательных путях молодых телят вызывает серьезное респираторное заболевание.

    Лечение инфекций верхних дыхательных путей противовирусными препаратами может предотвратить прогрессирование инфекции RSV в нижние дыхательные пути и потенциально снизить потребность в медицинском вмешательстве (15).Хотя текущая модель RSV крупного рогатого скота обеспечивает средства для количественной оценки конечных точек заболевания bRSV, она не моделирует кинетику прогрессирования инфекции верхних дыхательных путей в нижние, наблюдаемую у людей. Введение вируса интраназальной инокуляцией вместо доставки в виде аэрозоля могло бы обеспечить более естественный путь заражения, который мог бы отражать прогрессирование инфекции у людей, но потребовал бы существенной дополнительной оптимизации. Считается, что способ передачи естественной инфекции bRSV идентичен способу передачи у людей (44).Вирус в форме аэрозоля попадает в верхние дыхательные пути, и в результате инфекция вызывает симптомы со стороны верхних дыхательных путей, которые исчезают без медицинского вмешательства. Другие факторы, такие как экологический стресс или снижение защитных механизмов хозяина, которые ограничивают репликацию вируса в легких, увеличивают риск развития пневмонии и бронхиолита.

    Одной из проблем нынешней модели является естественная изменчивость конечных точек, измеряемых в первую очередь из-за различий в допустимости экспериментальной инфекции RSV среди отдельных животных.В то время как в текущем исследовании наблюдались устойчивые тенденции в отношении противовирусной эффективности, небольшие размеры выборки и вариабельность конечных результатов снижали статистическую мощность некоторых измеренных терапевтических эффектов, наблюдаемых у обработанных животных. Хотя результат исследования можно улучшить, увеличив количество животных, включенных в исследование, это вызовет дополнительные технические проблемы, связанные с эффективным обращением с большим количеством крупных животных во время терапевтического исследования.

    Дополнительной проблемой является вариабельная гомология bRSV и hRSV, требующая, чтобы соединения, разработанные для лечения hRSV, оценивались на противовирусную активность in vitro против bRSV для подтверждения перекрестной реактивности перед рассмотрением оценки in vivo на модели эффективности крупного рогатого скота. Обзор опубликованных противовирусных соединений RSV выявил несколько соединений, которые нацелены как на bRSV, так и на hRSV (см. Таблицу S5 в дополнительном материале). Было обнаружено, что ингибиторы полимеразы рибавирин и BI-D активны как против bRSV, так и против hRSV, в то время как ингибитор слияния TMC-353121, но не BMS-433771, был активен против обоих вирусов.Ингибитор нуклеокапсида RSV-604 и ингибитор полимеразы RSV YM-53403 были активны только против hRSV. Дифференциальные ответы на эти классы ингибиторов против RSV крупного рогатого скота подчеркивают необходимость оценки ингибиторов in vitro перед тестированием на модели RSV крупного рогатого скота.

    Хотя GS1 обеспечивал измеримую противовирусную эффективность, приводящую к снижению вирусной нагрузки, появление устойчивых к соединениям вариантов не оценивалось. В этих исследованиях мы не выделяли репликационно-компетентный вирус из носовых выделений для измерения чувствительности вируса к GS1 после лечения.

    В заключение, обработка GS1 телят голштинской породы, экспериментально инфицированных bRSV, обеспечила валидацию этой животной модели для оценки эффективности экспериментальных терапевтических средств для лечения инфекции RSV. Патофизиология заболевания в этой модели аналогична человеческой RSV-инфекции, а наличие количественных клинических конечных точек обеспечивает надежную систему для оценки эффективности терапевтических средств RSV. Лечение GS1, начатое через 3 дня после инокуляции, обеспечило измеримую противовирусную и клиническую эффективность, демонстрируя, что слияние RSV является эффективной мишенью для терапевтического противовирусного вмешательства.Эти данные согласуются с недавним исследованием, демонстрирующим клиническую эффективность GS-5806, ингибитора слияния RSV и близкого аналога GS1, у людей, экспериментально инфицированных RSV (20). Важно отметить, что, поскольку экспериментальная инфекция RSV у людей ограничивается в первую очередь верхними дыхательными путями, результаты тестирования GS1 на модели инфекции bRSV предполагают, что этот новый класс ингибиторов слияния RSV может эффективно подавлять инфекцию RSV как в верхних, так и нижних дыхательных путях. .Таким образом, результаты настоящих исследований показывают, что бычья RSV-инфекция у телят представляет собой подходящую модель на животных для оценки in vivo эффективности терапевтических средств RSV и должна способствовать продвижению доклинических испытаний и разработке новых вмешательств для лечения RSV. инфекционное заболевание.

    Эпизоды респираторно-синцитиального вируса (RSV) группы A (a) и группы B (b) …

    Контекст 1

    … были проанализированы с использованием Stata версии 11.2 (StataCorp, США). Данные по инфекциям подвергались интервальной цензуре, и были оценены три возможных продолжительности выделения вируса, то есть минимальная, средняя и максимальная, как описано в дополнительном онлайн-материале и показано на рисунке S1. Эпизод RSV-инфекции определялся как период, в течение которого человек предоставил образцы, которые были положительными по результатам ПЦР для той же самой инфицированной группы RSV, с разделением любых двух положительных образцов не более 14 дней. Эпизоды, когда первая проба была положительной для обеих групп А и В RSV, считались одним эпизодом инфекции.Эпизоды, когда образцы не собирались в течение> 7 дней до или после эпизода инфекции, считались подвергнутыми цензуре слева или справа соответственно. Симптоматическая инфекция определялась как наличие одного или нескольких из следующих симптомов: кашель, выделения из носа / заложенность носа или затрудненное дыхание в любой момент во время эпизода инфекции. Коинфекция была назначена, когда в эпизоде ​​RSV любой образец был положительным по ПЦР на другой вирус, то есть коронавирус, риновирус или аденовирус. Также было определено наличие этих вирусов в образцах, отобранных за 14 дней до начала эпизодов RSV.Вспышка в домашнем хозяйстве была определена как период, в течение которого у членов одного домохозяйства произошло несколько отдельных эпизодов без интервала в 514 дней, в течение которого в домохозяйстве отсутствовал ПЦР-положительный образец. Доля членов домохозяйства, инфицированных во время вспышек домохозяйств, измеряла интенсивность …

    Контекст 2

    … всего было зарегистрировано 205 эпизодов инфекции, из которых 155 человек пережили один эпизод, 22 человека — два эпизода и два человека. переживает три эпизода (рис.1). Группа А RSV была связана с 88 эпизодами инфекции, группа B RSV — со 113, а семь эпизодов были сопутствующими инфекциями. Полностью наблюдались 177 (86,3%) эпизодов, в то время как 11 и 15 эпизодов инфекции подвергались цензуре слева и справа, соответственно, а два эпизода подвергались цензуре как слева, так и справа. Из 24 человек с двумя или более эпизодами (подозрение на повторные инфекции) 17 (70,8%) были инфицированы одной и той же группой RSV, и в остальном все, за исключением одной группы A, последовали за группой B. с RSV группа A и группа B составила 2 · 3 и 7 · 2 года соответственно.Продолжительность между эпизодами варьировала от 17 до 54 дней, в среднем 28 дней. Для 17 гомологичных инфекций секвенирование гена RSV G было успешным в 10 (59%) из 18 возможных пар образцов (у одного человека было три подозреваемых эпизода RSV). Нарушение последовательности было в основном в образцах со значением порога цикла ПЦР (C t)> 28 · 0, показателем низкой вирусной нагрузки. Только один из успешно секвенированных парных образцов показал нуклеотидные различия: 13 нуклеотидных различий, связанных с тремя несинонимичными изменениями и изменением положения стоп-кодона.Эпизоды у этого человека (идентификационный номер 1803 на рис. 2) произошли с разницей в 54 дня. Для оценки продолжительности выделения были рассмотрены все эпизоды …

    Определение окна вакцинации против респираторно-синцитиального вируса (РСВ) с использованием данных о возрастной серологической распространенности для детей в Килифи, Кения

    Аннотация

    Фон

    Респираторно-синцитиальный вирус (RSV) — важная причина заболеваний нижних дыхательных путей в раннем возрасте и цель для вакцинопрофилактики.Данные о возрастной распространенности антител, специфичных к RSV, будут способствовать оптимизации доставки вакцины.

    Методы

    Заархивированные образцы плазмы были случайным образом отобраны в возрастных группах от 960 детей в возрасте до 145 месяцев, поступивших в педиатрические отделения больницы округа Килифи в период с 2007 по 2010 год. Образцы были протестированы на антитела к RSV с использованием неочищенного вирусного IgG ELISA. Распространенность серотипа (и 95% доверительный интервал) оценивалась как доля детей со специфическими антителами выше определенного порогового уровня.Вложенные каталитические модели использовались для изучения различных предположений о динамике антител и оценки скорости распада специфических материнских антител RSV и приобретения инфекции с возрастом, а также среднего возраста инфицирования.

    Результаты

    Распространенность специфических антител к

    RSV составляла 100% в возрасте от 0 до <1 месяца, быстро снижаясь в течение первых 6 месяцев жизни с последующим увеличением во второй половине первого года жизни и в последующий период. Распространенность серотипа была самой низкой в ​​возрастном диапазоне 5–11 месяцев; все дети были серопозитивными в возрасте старше 3 лет.Модель, наилучшим образом подходящая к данным, дала оценки скорости инфицирования 0,78 на человека в год (95% ДИ 0,65–0,97) и 1,69 на человека в год (95% ДИ 1,27–2,04) для возрастов от 0 до <1 года и 1- <12 лет соответственно. Скорость потери материнских антител была оценена как 2,54 / год (95% ДИ 2,30–2,90), т.е. средняя продолжительность 4,7 месяца. Средний возраст первичной инфекции был оценен в 15 месяцев (95% ДИ 13–18).

    Выводы

    Скорость снижения распространенности материнских антител и последующее возрастное приобретение инфекции являются быстрыми, а средний возраст первичного инфицирования — ранним.Окно вакцинации узкое и предполагает оптимальное нацеливание вакцины на детей в возрасте 5 месяцев и старше для достижения высокой сероконверсии.

    Образец цитирования: Ниро Дж. Ю, Комбе И. К., Санде С. Дж., Кипкуч Дж., Киюка П. К., Оньянго СО и др. (2017) Определение окна вакцинации против респираторно-синцитиального вируса (РСВ) с использованием данных о возрастной серораспространенности среди детей в Килифи, Кения. PLoS ONE 12 (5): e0177803. https://doi.org/10.1371/journal.pone.0177803

    Редактор: Джон С.Трегонинг, Имперский колледж Лондона, ВЕЛИКОБРИТАНИЯ

    Поступила: 30 января 2017 г .; Принято к печати: 3 мая 2017 г .; Опубликовано: 22 мая 2017 г.

    Авторские права: © 2017 Nyiro et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Все соответствующие данные находятся в документе и его файлах с вспомогательной информацией.

    Финансирование: Эта работа поддержана Wellcome Trust UK, номер гранта: [102975]; [084633] (https://wellcome.ac.uk/) в DJN. Спонсор не имел никакого отношения к дизайну исследования, сбору и анализу данных, принятию решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

    Введение

    Острая респираторная инфекция (ОРИ) является ведущей причиной заболеваемости и смертности среди детей младше 5 лет во всем мире [1], а респираторно-синцитиальный вирус (РСВ) является наиболее важным вирусным патогеном, ответственным за ежегодные эпидемии бронхиолита и пневмонии в эти маленькие дети [2–5].Глобальные оценки показывают, что RSV может вызывать около 0,3 миллиона случаев смерти детей младшего возраста в год, и 99% из них происходят в странах с низким уровнем дохода [1].

    На сегодняшний день нет лицензированных вакцин для профилактики RSV-инфекции у младенцев и детей раннего возраста. Некоторые вакцины-кандидаты показали многообещающие результаты [6–8]. Совсем недавно было показано, что аттенуированная вакцина MEDI ΔM2-2, разработанная с использованием систем обратной генетики, сильно ограничена в репликации и более иммуногенна у детей с серонегативным РСВ, чем предыдущие ведущие живые аттенуированные вакцины-кандидаты против РСВ [9].В результате эти результаты свидетельствуют о доступности многообещающей вакцины-кандидата для детей младшего и младшего возраста в ближайшем будущем.

    Основной целью вакцинации против RSV являются дети в возрасте до 6 месяцев; группа, очень восприимчивая к тяжелому заболеванию RSV [10]. Однако вакцинация этой возрастной группы осложняется, помимо прочего, наличием материнских антител [11]. Если предположить, что эффективность потенциальной вакцины значительно снижается, если ее вводить в присутствии материнских антител, отсюда следует, что возраст вакцинации следует отложить.Однако большинство первичных инфекций RSV передается в раннем возрасте [12], поэтому отсрочка вакцинации может привести к пропуску значительной части предотвратимых инфекций. Таким образом, период вакцинации или возраст должны быть установлены таким образом, чтобы иметь минимальное влияние материнских антител и чтобы большинство инфекций не произошло.

    Анализ возрастного профиля серологической распространенности может дать информацию о возрастном распределении на момент приступа заболевания в данной популяции. Данные предыдущих серологических исследований RSV-специфических антител предполагают раннее приобретение RSV-специфических антител в возрасте после распада материнских антител [13, 14].Было обнаружено, что распространенность RSV быстро увеличивается с возрастом, достигающим более 90% к трем годам и достижением 100% серопозитивности к 5 годам при средней продолжительности материнского антитела, оцениваемой в 3,3 месяца [14]. Однако динамика антител к RSV может потенциально затруднить интерпретацию возрастного профиля серологической распространенности. Присутствие материнских антител в возрасте примерно до шести месяцев может препятствовать приобретению антител через инфекцию в первые несколько месяцев жизни [15, 16].Кроме того, исследования показали, что как нейтрализующие, так и общие антитела, специфичные к RSV, приобретенные во время первичной инфекции, со временем уменьшаются до уровней, существовавших до инфицирования: около одного года для общих антител и трех месяцев для функциональных антител [15, 17]. Прямой анализ профиля серологической распространенности без попытки моделирования динамики этих антител может привести к недооценке истинной скорости инфицирования и возраста первичного инфицирования.

    Каталитические модели объясняют динамику антител как функцию возраста и используют стратифицированные по возрасту серологические данные для оценки силы инфекции.Простую каталитическую модель можно модифицировать, чтобы учесть различные структуры для неиммунизирующих инфекций [18] и различные формы функции силы инфекции [19–21]. Ранее каталитические модели использовались для оценки скорости распада материнских антител и скорости заражения восприимчивых людей на душу населения (сила инфекции) [19, 20, 22, 23]. Впоследствии можно установить средний возраст первичного заражения и «окно» вакцинации.

    В этом исследовании мы представляем возрастную распространенность антител к RSV в сельской местности на побережье Кении.Затем мы разрабатываем три вложенные каталитические модели, которые исследуют различные предположения о динамике специфических антител к RSV. Образцы были отобраны случайным образом из педиатрических госпиталей в окружной больнице в прибрежной Кении и проверены на антитела к RSV с помощью ELISA. Данные этого исследования обеспечивают базовое понимание естественного ответа на инфекцию RSV и имеют отношение к оптимальному возрасту доставки вакцины RSV.

    Материалы и методы

    Место исследования и население

    Мы использовали данные и архивные образцы плазмы детей в возрасте от 1 дня до 12 лет (т.е. <145 месяцев), которые были госпитализированы в педиатрические отделения больницы округа Килифи (KCH) в период с 2007 по 2010 год (включительно). Окружная больница, ранее известная как районная больница Килифи (KDH), расположена в сельской местности на побережье Кении. Кенийский институт медицинских исследований (KEMRI) -Wellcome Trust Research Program предоставляет клиническую помощь в педиатрических отделениях больниц и управляет Системой медицинского и демографического наблюдения Килифи (KHDSS), охватывающей территорию примерно в 900 км 2 , которая находится в пределах 50 км к северу, 50 км к югу , и в 30 км к западу от больницы, и включает население (по данным переписи 2010 г.) примерно 260 000 [24, 25].Пациенты, поступающие в больницу, проходят стандартный медицинский осмотр, сдают кровь при поступлении и регистрируются в регистре населения KHDSS [24].

    Участники исследования были отобраны случайным образом из регистра госпитализации Интегрированной системы управления данными Kilifi (KIDMS) независимо от диагноза и стратифицированы по возрасту на возрастные группы до 11 месяцев, затем 12- <15 мес., 15- <18 мес., 18- < 24 м, 24- <36 м, 36- <60 м, 60-84 м, 84- <108 м и 108 <145 м. Этих детей связывали с хранимыми образцами сыворотки, собранными при поступлении, которые извлекали, а аликвоту проверяли на наличие антител к RSV.Критериями включения было пребывание в KHDSS, госпитализация в KCH в период с 2007 по 2010 гг. И хранение пробы плазмы при поступлении. Все повторные госпитализации были исключены, то есть общее количество образцов в настоящем анализе в точности равно общему количеству участников исследования.

    Для уменьшения систематической ошибки, связанной с сезонной передачей, и для обеспечения средней серологической распространенности при наличии сезонных и долгосрочных колебаний в передаче, выборка поперечного сечения охватывала период в четыре года.Каждый год был разделен на кварталы, каждый квартал содержал 60 выборок, так что в каждой из 20 возрастных групп было по 3 образца. Это дало в общей сложности 960 образцов за 4-летний период, по 240 образцов каждый год. Из 960 образцов в каждой из 20 возрастных групп было 48 образцов, 12 собираемых каждый год. Размер выборки был оценен стандартными методами, чтобы обеспечить оценку точности серотипа 50% в пределах +/- 14%.

    Этическое разрешение

    Все родители и опекуны дали письменное согласие на участие их детей в педиатрическом стационарном наблюдении в KCH и на хранение образцов крови для использования в будущих исследованиях.Комитет по этике KEMRI одобрил это исследование.

    Лабораторные процедуры

    Все пробы плазмы при поступлении были протестированы на концентрацию антител с помощью метода ELISA на основе IgG с использованием неочищенного вирусного экстракта из адаптированной в лаборатории культуры RSV A2 и специфических концентраций антител, записанных в виде логарифмических произвольных единиц, как определено с помощью процедуры местных стандартов. Оптимальные разведения для антигена RSV-A2 и сыворотки определяли титрованием в шахматном порядке. Приготовление неочищенного вирусного лизата RSV было таким, как описано ранее Ochola et al [16].Процедуру ELISA на RSV IgG выполняли, как описано ранее [16].

    Образцы были проанализированы в двух экземплярах, чтобы учесть любые вариации в процессе анализа, например, вызванные ошибками пипетирования. В каждом планшете вместе с образцами запускали как высокий, так и низкий контроль. График был построен с течением времени для проверки как стандартов, так и антигена покрытия.

    Объединенную стандартную сыворотку взрослых, серийно разведенную в 2-кратных разведениях от 1:50 до 1: 2800, обрабатывали в каждом планшете для построения стандартной кривой.Значениям OD стандартных разведений сывороток были присвоены значения произвольных единиц (AU). Стандартизованные произвольные единицы (и log 10 преобразованных) RSV-специфического IgG для образцов оценивали путем интерполяции стандартной кривой, полученной из объединенной сыворотки взрослых (стандарт сыворотки), тестируемой в каждом прогоне ELISA.

    Частотное распределение значений log 10 AU для всех отобранных сывороток было выполнено для определения подходящей границы между серопозитивным и серонегативным статусом. Точка отсечения 1.5, как ранее было применено Ochola et al, [16], был использован в этом исследовании для определения серостатуса RSV, так как это пороговое значение также определяло положительные и отрицательные стороны в бимодальном распределении в этом исследовании, как показано на (Рис. 1).

    Рис. 1. Графики титров антител к RSV.

    Верхний ряд: точечные диаграммы уровня титра антител по возрастным группам. Нижний ряд: гистограммы титров антител по возрастным группам. Красные линии показывают пороговое значение 1,5, используемое для определения серопозитивности.

    https: // doi.org / 10.1371 / journal.pone.0177803.g001

    Статистический анализ

    Данные были проанализированы с использованием STATA версии 11 (StataCorp, College Station, Texas, USA). Пропорции выборок в каждом возрастном классе были получены с 95% доверительным интервалом.

    Моделирование риска первичной инфекции RSV

    Мы оценили связанный с титром риск первичной инфекции RSV и скорость потери материнских антител одновременно, используя вложенную каталитическую модель, построенную на основе простой модели.Вложенная модель позволяет исследовать различные предположения о динамике антител на уровне популяции. Мы предположили, что антитела были получены при передаче от матери или в результате инфицирования.

    Каталитическая модель — это модель на уровне популяции; индивиды сгруппированы в разные состояния (отсеки) в зависимости от допущений в модели. Простая каталитическая модель имела два отсека: (i) долю восприимчивых и серонегативных в каждой возрастной группе, a , т.е. S (a) , и (ii) долю (когда-либо) инфицированных по возрасту, F ( а) .К «(когда-либо) инфицированным» относятся инфицированные и выздоровевшие. Оцениваемый параметр — это уровень инфицирования на душу населения в год (сила заражения), например если оценка дана как 0,5 на человека в год, это означает, что каждый испытывает инфекционное давление, эквивалентное 0,5 заражения в год (1 инфекция каждые 2 года). Чтобы учесть присутствие материнских антител, были введены отсек M (a) и параметр скорости распада материнских антител.В этом случае модель предполагала, что присутствие материнских антител является рефракционным по отношению к инфекции. Компартмент M (a) затем был разделен на 2, изменив распределение продолжительности материнских антител с экспоненциального на эрланговский с параметром формы, равным 2. Эта модификация означает, что более длительные материнские антитела имеют более высокие вероятности, чем более короткие. продолжительность.

    Мы исследовали три основные формы структуры вложенной модели (рис.2), которые исследуют возможные эффекты временных антител RSV после первичной инфекции и, косвенно, возрастную заболеваемость на человека (т.е. возрастная сила инфекции), как описано:

    Рис. 2. Структура вложенной модели для изучения данных о возрастной распространенности RSV с использованием моделей каталитической инфекции.

    Компартменты в модели представляют следующие состояния популяции: M = лица с материнскими антителами (разделены на 2, M 1 и M 2 для улучшения соответствия), S 0 = серонегативный после потеря материнских антител, F 0 = постоянный серопозитивный статус после инфекции, F 1 = временный серопозитивный статус после первичной инфекции, S 1 = серонегативный после потери антител, приобретенных инфекцией.Когда p = 0, модель сводится к MSF, когда p = 1 и оценивается только 1 уровень заражения 0 = λ 1 ), модель — MSFSF 1 и с p = 1 и 2 оценками степени заражения 0 ≠ λ 1 ) модель — MSFSF 2 .

    https://doi.org/10.1371/journal.pone.0177803.g002

    MSF.

    В нулевом возрасте все люди серопозитивны в отношении приобретенных матерью антител к RSV, M-компартмент.Они теряют свой материнский серопозитивный статус с постоянной скоростью σ, попадая в восприимчивый компартмент S 0 , в котором они заражаются с постоянной скоростью λ 0 и попадают в класс (когда-либо) инфицированных F 0 . В F 0 у них возникают последующие инфекции с неизвестной частотой, пока они серопозитивны.

    MSFSF
    1 0 = λ 1 ).

    Это расширение модели MSF, где доля, p = 1, заразится со скоростью λ 0 и попадет в отсек F 1 , но впоследствии потеряет свой серопозитивный статус со скоростью δ и присоединится к S 1 класс восприимчивых веществ.Из S 1 они повторно заражаются со скоростью λ 1 и переходят в класс F 0 после повторного заражения и испытывают последующие инфекции, будучи серопозитивными.

    MSFSF
    2 0 ≠ λ 1 ).

    Расширение MSFSF 1 0 = λ 1 ) , но с первичной силой заражения λ 0 не равно вторичная сила заражения λ 1 .

    Структура модели показана на (Рис. 2), а параметры описаны в Таблице 1. Представленная вложенная структура предполагает, что присутствие материнских антител влияет на инфекцию, что не обязательно так. Позже мы модифицируем это предположение, допуская инфекцию в M-компартментах. Также был изучен другой порог для серопозитивного статуса для детей в возрасте 6 месяцев и младше. Мы учли зависимость силы инфекции от возраста. В моделях MSF и MSFSF 1 функция выбиралась ступенчато для возрастов 0–1 год и 1–12 лет.Обоснование шагов можно найти в S1 Text. Зависимость от возраста неявно присутствует в модели MSFSF 2 . Кроме того, не учитывались процессы рождения и смерти.

    Подбор параметров был выполнен с использованием оценки максимального правдоподобия (MLE) [24] в Matlab версии 7 (MathWorks, Массачусетс, США). ОДУ для модели были решены численно с использованием функции ode45 , которая основана на явной формуле Рунге-Кутта (4,5), пары Дорман-Принс. Оптимизация была выполнена с использованием функции fmincon , которая применяет нелинейную оптимизацию с ограничениями.Две модели во вложенной структуре имеют одинаковое количество оцениваемых параметров; Поскольку такое сравнение моделей было выполнено с использованием информационного критерия Акаике второго порядка (AIC C ). Доверительные интервалы для параметров были установлены путем повторной подгонки модели к набору самонастраиваемых выборок данных. Повторная выборка была сделана 1000 раз, и 95% доверительный интервал был установлен с использованием 2,5 -го и 97,5 -го процентилей [25].

    Используя оцененные параметры, мы вычислили средний возраст первичной инфекции A , используя формулу, где для 12 возрастных групп от 0 до 1 года и 8 возрастных групп от 1 до 12 лет и оптимального возраста для вакцинации Av , используя формулу модификации оригинала [26].Здесь мы определяем оптимальный возраст для вакцинации как возраст, при котором влияние материнских антител будет минимальным и большинство инфекций не произойдет, что определяется серопозитивным статусом.

    Результаты

    Описание участников исследования

    Из регистрационного реестра было отобрано 960 детей, разделенных на 20 возрастных групп, по 48 детей в каждой группе. Четыреста одна женщина (41,8%) была женщиной. На основании первичного диагноза при выписке 298 (31.0%) поступили с инфекцией нижних дыхательных путей (ИДПТ), 181 (18,8%) с гастроэнтеритом, 174 (18,1%) с другими состояниями (проблемы с сердцем, лимфома Беркитта, эпилепсия, гидроцефалия), 145 (15,1%) с другими инфекционными заболеваниями , 57 (5,9%) малярия, 39 (4,1%) недоедание, 37 (3,9%) врожденные заболевания, 17 (1,7%) анемия, а у 12 (1,2%) диагноз не был установлен. Из тех, кому был поставлен диагноз ИНДП, у 16% (5% участников исследования) была подтвержденная антигеном инфекция RSV [27, 28].

    Возрастная серологическая распространенность антител к RSV

    Общая серологическая распространенность составила 65.7% (95% ДИ: 62,7–68,7). У всех детей младше 1 месяца серологическая распространенность была 100%. Распространенность серотипа снизилась с 91,7% через 1 месяц до минимума 25% через 6 месяцев. После этого наблюдался медленный рост от 6 месяцев до 9 месяцев, а затем быстрое изменение серологической распространенности с 41,7% (от 11 до <12 месяцев), 52,1% (от 12 до <15 месяцев), 56,3% (от 15 до <18 месяцев), 83,3% (от 18 до <24 месяцев), 93,8% (от 24 до <36 месяцев) и 100% (от 36 до <60 месяцев). Все дети старше 3 лет были серопозитивными. Доля серопозитивных в возрастной группе показана в таблице 2.

    Оценки заболеваемости первичной инфекцией RSV, средний возраст инфицирования и оптимальный возраст для вакцинации

    Мы исследовали различные допущения в трех вложенных каталитических моделях и сравнили соответствие данным; подробные результаты показаны в таблице S1 в тексте S1. Подробности процесса выбора модели описаны в S1 Text. Короче говоря, данные подтверждают использование двух классов M, а не одного, и ступенчатую функцию силы заражения, а не константу. Из трех вложенных моделей простейшая модель (MSF) наилучшим образом соответствует данным с наименьшим отрицательным логарифмическим правдоподобием и значениями AIC C .Результаты показаны в Таблице 3 и (Рис. 3).

    Модель MSF дала скорость потери материнских антител 2,54 / год (95% ДИ 2,30–2,90) и силу инфицирования 0,78 / человека в год (95% ДИ 0,65–0,97) для детей в возрасте от 0 до 1 года и 1,69 на человека в год (95% ДИ 1,27–2,04) в возрасте от 1 до 12 лет. (Рис. 4) показывает соответствие для MSF и 95% доверительный интервал, установленный в результате переоснащения модели с использованием данных начальной загрузки. Исходя из этих результатов, средняя продолжительность материнских антител ( D M ) составляет 4.72 (95% ДИ: 4,14–5,22) месяца, рассчитанных как обратная скорость разложения. Средний возраст первичной инфекции ( A) составляет 15,1 (95% ДИ 12,7–18,5) месяцев, тогда как средний оптимальный возраст для вакцинации составляет 6,8 месяцев (95% ДИ 6,2–7,5). Модельные прогнозы пропорции серопозитивных и силы инфекции, действующей на людей разного возраста, показаны на (Рис. 5).

    Рис. 4. Результаты подбора модели MSF и доверительной области.

    Основная: Из трех моделей во вложенной структуре модели, модель MSF дала наилучшее соответствие данным и показана синей линией.Параметры были переоценены для получения совпадений, которые дали 95% доверительную область методом начальной загрузки, серые линии. Красные кружки показывают долю серопозитивных по возрастным группам согласно данным. Врезка: увеличение для возрастного диапазона 0–3 года.

    https://doi.org/10.1371/journal.pone.0177803.g004

    Рис. 5. Модель MSF, предсказывающая пропорции серопозитивных и силу инфекции, действующие на людей разного возраста.

    Темно-синие столбцы показывают долю в разных возрастных группах, у которых есть материнские антитела, а розовые столбцы показывают долю инфицированных и, следовательно, имеющих антитела, приобретенные инфекцией, согласно прогнозам модели MSF.Пунктирная синяя линия показывает ступенчатую силу функции заражения.

    https://doi.org/10.1371/journal.pone.0177803.g005

    Образцы, включенные в этот анализ, были взяты у госпитализированных детей с разными диагнозами при выписке. В их число были включены дети с диагнозом НИОТ, часть которых была положительной по антигену РСВ. Чтобы проверить, привело ли включение этих образцов к какому-либо смещению, модель MSF со ступенчатой ​​силой заражения была изменена на 2 подмножества данных; исключая LRTI и положительные по антигену RSV.Оценки параметров, полученные в результате этих аппроксимаций, не отличались от оценок, полученных с использованием всех данных. Это показано на фиг. S2 в тексте S1.

    Структура модели была изменена, чтобы ослабить предположение о том, что присутствие материнских антител влияет на инфекцию. Сила инфекции, действующей на детей до потери материнских антител, была оценена как 0,0 на человека в год, что указывает на то, что данные не подтверждают этот процесс инфекции (результаты не показаны). Пороговое значение для серопозитивности в возрасте 0–6 месяцев варьировалось, чтобы попытаться учесть различия между антителами, приобретенными у матери и антителами, приобретенными в результате инфекции.Мы исследовали диапазон отсечки от 1,5 до 2 с шагом 0,25. Увеличение порогового значения привело к увеличению скорости потери материнских антител и снижению силы инфекции. Оценка рекомендуемого оптимального возраста вакцинации, однако, сохранила относительно узкий интервал в 4,7–7,1 месяца с различными пороговыми значениями, что дает (таблица S2 в тексте S1).

    Обсуждение

    Вмешательство вакцины, вероятно, будет ключевым в борьбе с тяжелым заболеванием, связанным с инфекцией RSV.До внедрения вакцины важной исходной информацией будут эпидемиологические параметры, такие как сила заражения и средний возраст первичного инфицирования. Анализ возрастных данных о серологической распространенности может дать информацию о силе инфекции в данной популяции при отсутствии вакцинации. В этом исследовании мы представляем профиль распада материнских антител и последующее приобретение антител к RSV в зависимости от возраста среди детей в Килифи, а также оцениваем силу инфекции, средний возраст первичного инфицирования и оптимальный возраст для доставки вакцины RSV.

    Использование случайно выбранных образцов плазмы стационарных пациентов детей в возрасте от 0 до 12 лет не внесло систематической ошибки в оценку серологической распространенности в этом исследовании, как можно было бы предположить. Исключение всех участников с LRTI или RSV-положительным антигеном, подтвержденным IFAT / молекулярным методом, не привело к значительным изменениям в профилях серологической распространенности. Интересно, что анализ данных о диагнозе при выписке показал, что 31% госпитализаций, выбранных для этого исследования, были вызваны ИДП, а 16% госпитализаций с ИНДП были вызваны РСВ.Это ясно показывает, что RSV является основной причиной заболеваний нижних дыхательных путей у детей в данной ситуации, что согласуется с предыдущими выводами [10, 27].

    Серологическая распространенность RSV варьировала с возрастом и показала 100% -ную серопозитивность в образцах, взятых у детей первого месяца жизни, т.е. <1 месяца. Этот процент снизился до 25% в возрастной группе 6–7 месяцев, затем снова повысился до 100% в возрастной группе 3 года и оставался таковым вплоть до 12 лет. Хотя данные не распространяются на взрослых, этот профиль качественно аналогичен тому, что можно было бы наблюдать при иммунизации инфекций, таких как корь [29].В серологическом исследовании RSV, проведенном Cox et al [14] в Бразилии, был получен аналогичный профиль с набором данных, который распространился на возрастную группу 31–40 лет. Быстрый рост процента серопозитивных, наблюдаемый в наших данных, указывает на высокий уровень инфицирования среди нынешнего населения. Высокие показатели инфицирования, связанные с частыми повторными инфекциями, также наблюдались в других исследованиях [30–32], что означает, что результаты нашего анализа могут быть обобщены для других условий.

    Интерпретация данных о возрастной распространенности RSV может быть затруднена по нескольким причинам.Уменьшение количества антител после первичной инфекции может означать изменение серологического статуса. Также может быть возрастная зависимость скорости заражения. Мы исследовали множество каталитических моделей, основанных на различных предположениях о свойствах антител, специфичных к RSV. Включение зависящей от возраста силы инфекции обеспечило лучшее соответствие данным с допущением или без допущения реверсии серологического статуса после первичной инфекции. Интерпретация этого результата заключается в том, что, хотя наблюдается уменьшение количества антител после первичной инфекции, скорость повторного заражения настолько высока, что данные не могут отличить модель с процессом или без него.Если, однако, вакцинация должна была снизить скорость передачи вируса, то влияние на профиль возрастной распространенности могло бы быть более выраженным и повлиять на интерпретацию таких данных.

    Простейшая модель (MSF) дала оценку средней продолжительности материнских антител (D M ) в 4,7 месяца, а средний возраст первичной инфекции (A) — в 15,1 месяца. Они не сильно отличались от D M = 4,42 месяца и A = 14,2 месяца, полученных из модели, которая допускает уменьшение антител после первичной инфекции (модель MSFSF 1 ).Для сравнения, сероэпидемиологическое исследование, проведенное Cox et al [14] по данным RSV из Бразилии, оценило продолжительность материнских антител в 3,3 месяца. Эта оценка была получена путем аппроксимации данных экспоненциальной функцией. Ochola et al [16] получили оценки продолжительности материнских антител в 3,7 месяца (112 дней), используя данные когорты новорожденных и методы ELISA, аналогичные настоящему исследованию. Kinyanjui et al [33] оценили продолжительность защиты материнскими антителами в диапазоне 2–4,5 месяца, используя данные госпитализаций и детерминированную модель RSV с возрастной структурой.

    Amaku et al [20] сопоставили каталитическую модель с зависимой от возраста функцией силы инфекции и серологическими данными из Бразилии, те же данные использовались Cox et al [14]. По оценкам анализа, средний возраст инфицирования составлял 19,08 месяцев (95% ДИ 16,68–21,48), а сила инфекционной функции достигла пика примерно 0,9 на человека в год в возрастной группе 2 года. Окно вакцинации (определяемое как период между средней продолжительностью действия материнских антител и средним возрастом первого инфицирования), предложенное Бразильскими результатами Cox et al и Amaku et al [14, 20] 3.3–19,1 месяца, шире, чем предполагаемый по нашим результатам 4,7–15,1 месяца, хотя и примерно аналогичен. Как показал анализ возрастно-серологических данных по кори, окно вакцинации может варьироваться в зависимости от места проживания даже в пределах одного и того же уровня дохода [34]. Маклин и Андерсон [34] установили окно вакцинации против кори продолжительностью 3–13 месяцев для Сенегала (данные за 1957 г.) и окно в 6–38 месяцев для Таиланда (данные за 1967 г.).

    Оценка силы инфекции, действующей на детей, у которых все еще есть материнские антитела, в 0,0 на человека в год, согласуется с исследованиями, которые показывают, что реакция младенца на IgG после первичной инфекции очень низкая [15, 16, 32], и Фактически, Ochola et al [16] показали, что изначальная скорость распада материнских антител не отличалась от скорости распада, включая младенцев, перенесших RSV-инфекцию.Оценка параметров нашей модели при исключении положительного образца LRTI и положительного образца RSV дала исходные материнские скорости распада антител 2,56 / год и 2,45 / год, не сильно отличаясь от 2,54 / год, полученных с полным набором данных. Варьирование порогового значения серопозитивности для возрастной группы 0–6 месяцев привело к продолжительности действия материнских антител, аналогичной другим исследованиям, но не привело к радикальному изменению рекомендуемого оптимального возраста вакцинации.

    Оптимальное время для вакцинации детей для предотвращения инфекции — это возраст после потери материнскими антителами (которые могут помешать вакцине) и до их первой инфекции.Доля положительных на антитела к RSV начинает расти вскоре после 6 месяцев из-за инфекции как таковой; отсрочка вакцинации может привести к упущению значительного количества предотвратимых инфекций / заболеваний. Анализ профиля возрастной серологической распространенности позволяет предположить, что вакцинацию следует проводить примерно в 6 месяцев, когда серопозитивность находится на самом низком уровне. Однако при использовании более формального подхода результаты каталитических моделей предполагают период от 5 до 15 месяцев. Учитывая, что сила инфекции, оцененная для возраста 1–12 лет, вдвое больше, чем для возраста 0–1 года, что подразумевает больший риск заражения через 12 месяцев, можно предположить, что вакцинация должна проводиться между 5 и 12 месяцами.Окно вакцинации, установленное нашим анализом, перекрывается с окном вакцинации от 5 до 10 месяцев, полученным Kinyanjui et al. С использованием структурированной по возрасту детерминированной компартментальной модели RSV и данных из того же места, что и наше исследование [33]. Преимущество отсрочки вакцинации, предложенной моделью Kinyanjui et al [33], объясняется отсрочкой, позволяющей уменьшить количество материнских антител, но все еще достаточно ранней, чтобы предшествовать высокой интенсивности инфекции на втором году жизни. Кроме того, эффект снижения передачи инфекции в сообществе, возникающий в результате более поздней вакцинации младенцев (коллективный иммунитет), обеспечит косвенную защиту от инфекции у детей, слишком маленьких для вакцинации.Модель Kinyanjui et al. Кардинально отличается от модели, использованной в текущем анализе, однако обнадеживает тот факт, что рекомендуемое окно вакцинации устойчиво к различным подходам к моделированию и типам данных.

    Каталитическая модель, использованная в текущем анализе, относительно проста. В структуру можно вносить изменения, чтобы учесть различную динамику антител. Однако мы обнаружили, что не было никакой дополнительной пользы от включения потери антител после первичной инфекции или допущения инфекции, когда она была серопозитивной по материнским антителам.Динамика антител, такая как ослабление, которая наблюдалась на индивидуальном уровне, не подтверждалась моделью и данными, использованными в этом анализе. Для лучшего понимания этого может быть более подходящим анализ, аналогичный тому, который был проведен Kucharski et al [35], где выходными данными модели являются титры индивидуального уровня. Настоящий анализ дополняет растущий объем данных о динамике инфицирования RSV и рекомендации по стратегиям борьбы. Младенческую вакцинацию следует делать детям в возрасте от 5 до 12 месяцев.В зависимости от продолжительности предоставляемой защиты может потребоваться оптимизация вакцинации по времени года относительно сроков эпидемии RSV. Анализ, аналогичный нынешнему, проведенный после того, как программа вакцинации вступила в силу, может помочь в количественной оценке эффективности; ожидается, что сила заражения и средний возраст первичного инфицирования уменьшатся.

    Благодарности

    Эта статья опубликована с разрешения директора КЭМРИ. Мы благодарим всех добровольцев исследования за предоставленные образцы исследования.Мы благодарим полевых и лабораторных сотрудников исследовательской программы KEMRI Wellcome Trust за сбор и хранение образцов. Мы также признательны Г.Ф. Medley за его комментарии к более ранним версиям рукописи.

    Вклад авторов

    1. Концептуализация: DJN JUN.
    2. Обработка данных: JUN PKM.
    3. Формальный анализ: IKK JUN TMK.
    4. Получение финансирования: DJN.
    5. Расследование: JUN JK PKK COO CJS.
    6. Методология: JUN IKK DJN.
    7. Администрация проекта: ИЮН.
    8. Ресурсы: DJN.
    9. Программное обеспечение: IKK.
    10. Кураторство: DJN.
    11. Проверка: TMK DJN.
    12. Визуализация: JUN IKK.
    13. Написание — черновик: JUN IKK.
    14. Написание — просмотр и редактирование: CJS PKM TMK DJN COO.

    Список литературы

    1. 1.Наир Х., Симоэс Э.А., Рудан И., Гесснер Б.Д., Аззиз-Баумгартнер Э., Чжан Дж.С. и др. Глобальное и региональное бремя госпитализаций по поводу тяжелых острых инфекций нижних дыхательных путей у детей раннего возраста в 2010 г .: систематический анализ. Ланцет. 2013; 381 (9875): 1380–90. pmid: 23369797
    2. 2. Ли М.С., Уокер Р.Э., Мендельман П.М. Медицинское бремя респираторно-синцитиального вируса и инфекции вируса парагриппа 3 типа среди детей в США. Значение для дизайна испытаний вакцин. Hum Vaccin.2005; 1 (1): 6–11. pmid: 17038832
    3. 3. Куни МК, Фокс JP, Холл CE. Сиэтлский вирусный дозор. VI. Наблюдения за инфекциями и заболеваниями, вызванными парагриппом, эпидемическим паротитом, респираторно-синцитиальными вирусами и Mycoplasma pneumoniae. Am J Epidemiol. 1975; 101 (6): 532–51. pmid: 168766
    4. 4. Нойола Д.Е., Артеага-Домингес Г. Вклад респираторно-синцитиального вируса, вирусов гриппа и парагриппа в развитие острых респираторных инфекций в Сан-Луис-Потоси, Мексика.Pediatr Infect Dis J. 2005; 24 (12): 1049–52. pmid: 16371864
    5. 5. Чанок Р., Шамбон Л., Чанг В., Гонсалвес Феррейра Ф., Гарпуре П., Грант Л. и др. Обследование ВОЗ респираторных заболеваний у детей: серологическое исследование. Bull World Health Organ. 1967; 37 (3): 363–9. pmid: 5301380
    6. 6. Райт П.Ф., Каррон Р.А., Белше Р.Б., Ши Дж.Р., Рэндольф В.Б., Коллинз П.Л. и др. Отсутствие усиленного заболевания респираторно-синцитиальным вирусом дикого типа после получения живых ослабленных респираторно-синцитиальных вирусных вакцин.Вакцина. 2007; 25 (42): 7372–8. pmid: 17868959
    7. 7. Райт П.Ф., Каррон Р.А., Белше Р.Б., Томпсон Дж., Кроу Дж. Э. мл., Бойс Т.Г. и др. Оценка живого, холодного пассирования, чувствительного к температуре, респираторно-синцитиального вируса-кандидата в младенчестве. J Infect Dis. 2000; 182 (5): 1331–42. pmid: 11010838
    8. 8. Каррон Р.А., Райт П.Ф., Белше Р.Б., Тумар Б., Кейси Р., Ньюман Ф. и др. Идентификация рекомбинантного живого аттенуированного респираторно-синцитиального вируса-кандидата на вакцину, который сильно аттенуирован у младенцев.J Infect Dis. 2005; 191 (7): 1093–104. pmid: 15747245
    9. 9. Каррон Р.А., Луонго С., Тумар Б., Лоер К.М., Энглунд Дж. А., Коллинз П. Л. и др. Делеция гена, которая активирует экспрессию вирусного гена, дает аттенуированную вакцину против RSV с улучшенными ответами антител у детей. Sci Transl Med. 2015; 7 (312): 312ra175. pmid: 26537255
    10. 10. Nokes DJ, Ngama MJ, Bett A, Abwao J, Munywoki P, English M и др. Заболеваемость и тяжесть респираторно-синцитиальной вирусной пневмонии у сельских кенийских детей выявлены в ходе стационарного наблюдения.Клинические инфекционные болезни. 2009; 49 (9): 1341–1349. pmid: 19788358
    11. 11. Зигрист CA, Ламберт PH. Материнский иммунитет и реакция младенца на иммунизацию: факторы, влияющие на реакцию младенца. Dev Biol Stand. 1998; 95 (133–9. Pmid: 9855423
    12. 12. Faneye A, Motayo BO, Adesanmi A, Onoja B. Оценка антител IgG против респираторно-синцитиального вируса (RSV) и связанных факторов риска тяжелых инфекций дыхательных путей у детей дошкольного возраста в Северо-Центральном регионе Нигерии.Afr J Infect Dis. 2014; 8 (2): 36–9. pmid: 25729535
    13. 13. Брюссоу Х., Верчау Х., Сидоти Дж., Балло С., Рахим Х., Диррен Х. и др. Возрастная распространенность сывороточных антител к респираторно-синцитиальному вирусу у детей Эквадора и Германии. J Infect Dis. 1991; 163 (3): 679–80.
    14. 14. Кокс MJ, Азеведо RS, Cane PA, Massad E, Medley GF. Сероэпидемиологическое исследование респираторно-синцитиального вируса в штате Сан-Паулу, Бразилия. J Med Virol. 1998; 55 (3): 234–9. pmid: 9624612
    15. 15.Welliver RC, Kaul TN, Putnam T.I, Sun M, Riddlesberger K, Ogra PL. Антительный ответ на первичную и вторичную инфекцию респираторно-синцитиальным вирусом: кинетика классоспецифичных ответов. J Pediatr. 1980; 96 (5): 808–13. pmid: 7365579
    16. 16. Очола Р., Санде С., Феган Г., Скотт П.Д., Медли Г.Ф., Кейн П.А. и др. Уровень и продолжительность RSV-специфических материнских IgG у младенцев в Килифи, Кения. PLoS One. 2009; 4 (12): e8088. pmid: 19956576
    17. 17. Sande CJ, Mutunga MN, Okiro EA, Medley GF, Cane PA, Nokes DJ.Кинетика нейтрализующего ответа антител на респираторно-синцитиальные вирусные инфекции в когорте новорожденных. J Med Virol. 2013; 85 (11): 2020–5. pmid: 23983183
    18. 18. Винницкий Э., Белый Р., Введение в моделирование инфекционных заболеваний. 2010: ОУП Оксфорд.
    19. 19. Гренфелл Б.Т., Андерсон Р.М. Оценка возрастных показателей инфицирования на основании сообщений о случаях заболевания и серологических данных. Журнал гигиены. 1985; 95 (419–436. Pmid: 4067297
    20. 20. Амаку М., Азеведо Р.С., Кастро Р.М., Массад Э., Коутиньо Ф.А.Связь между эпидемиологическими параметрами шести детских инфекций в неиммунизированном бразильском сообществе. Mem Inst Oswaldo Cruz. 2009; 104 (6): 897–900. pmid: 19876563
    21. 21. Моссонг Дж., Путц Л., Шнайдер Ф. Распространенность и сила заражения вирусом ветряной оспы в Люксембурге. Epidemiol Infect. 2004; 132 (6): 1121–7. pmid: 15635970
    22. 22. Гриффитс Д.А. Каталитическая модель заражения корью. Прикладная статистика. 1974; 23 (3): 330–339.
    23. 23.Фаррингтон CP. Моделирование сил заражения корью, эпидемическим паротитом и краснухой. Статистика в медицине. 1990; 9 (953–967. Pmid: 2218197
    24. 24. Уильямс Б.Г., Дай С. Максимальная вероятность для паразитологов. Паразитология сегодня. 1994; 10 (2): 489–493.
    25. 25. Зубир А.М., Боашаш Б. Бутстрап и его применение в обработке сигналов. Журнал обработки сигналов, IEEE. 1998; 15 (1): 56–76.
    26. 26. Кацманн В., Дитц К. Оценка возрастных стратегий вакцинации.Теоретическая популяционная биология. 1984; 25 (2): 125–137. pmid: 6729750
    27. 27. Беркли Дж. А., Мунивоки П., Нгама М., Казунгу С., Абвао Дж., Бетт А. и др. Вирусная этиология тяжелой пневмонии у младенцев и детей в Кении. ДЖАМА. 2010; 303 (20): 2051–7. pmid: 20501927
    28. 28. Nokes DJ, Ngama M, Bett A, Abwao J, Munywoki P, English M и др. Заболеваемость и тяжесть респираторно-синцитиальной вирусной пневмонии у сельских кенийских детей выявлены в ходе стационарного наблюдения.Clin Infect Dis. 2009; 49 (9): 1341–9. pmid: 19788358
    29. 29. Уильямс Б.Г., Каттс Ф.Т., Дай С. Политика вакцинации против кори. Эпидемиология и инфекция. 1995; 115 (603–621. Pmid: 8557092
    30. 30. Ohuma EO, Okiro EA, Ochola R, Sande CJ, Cane PA, Medley GF и др. Естественная история респираторно-синцитиального вируса в когорте новорожденных: влияние возраста и перенесенной инфекции на повторное инфицирование и болезнь. Am J Epidemiol. 2012; 176 (9): 794–802. pmid: 23059788
    31. 31.Холл C, Гейман Дж., Биггар Р., Коток Д., Хоган П., Дуглас Р. Дж.. Инфекции респираторно-синцитиальным вирусом внутри семьи. Медицинский журнал Новой Англии. 1976; 294 (414–419. Pmid: 173995
    32. 32. Куцая А., Терос-Яаккола Т., Каккола Л., Тойвонен Л., Пелтола В., Варис М. и др. Проспективное клиническое и серологическое наблюдение в раннем детстве выявило высокий уровень субклинической инфекции RSV и относительно высокий уровень повторного инфицирования в течение первых 3 лет жизни. Epidemiol Infect.2016; 144 (8): 1622–33. pmid: 26732801
    33. 33. Kinyanjui TM, House TA, Kiti MC, Cane PA, Nokes DJ, Medley GF. Индуцированный вакциной коллективный иммунитет для контроля респираторно-синцитиального вирусного заболевания в странах с низким уровнем доходов. PLoS One. 2015; 10 (9): e0138018. pmid: 263
    34. 34. Маклин А.Р., Андерсон Р.М. Корь в развивающихся странах. Часть I Эпидемиологические параметры и закономерности. Эпидемиология и инфекция. 1988; 100 (111–133. Pmid: 3338500
    35. 35.Кухарски А.Дж., Лесслер Дж., Рид Дж.М., Чжу Х., Цзян К.К., Гуань Ю. и др. Оценка продолжительности жизни антител к гриппу A (h4N2) на основе поперечных данных. PLoS Biol. 2015; 13 (3): e1002082. pmid: 25734701

    границ | Ответы антигенных сайт-специфичных конкурентных антител на слитный белок респираторно-синцитиального вируса были связаны с вирусным клиренсом при трансплантации гемопоэтических клеток Взрослые

    Введение

    Респираторно-синцитиальный вирус (RSV) представляет собой одноцепочечный РНК-вирус отрицательного смысла из семейства Pneumoviridae .RSV передается через фомиты и крупнокапельные аэрозоли. РСВ, традиционно считающийся наиболее частым респираторным патогеном у детей младше 5 лет, недавно был обнаружен как наиболее распространенный среди лиц с ослабленным иммунитетом (1, 2). RSV также является ведущей причиной тяжелых респираторных инфекций у детей и взрослых с ослабленной иммунной системой, при этом уровень смертности достигает 80% (3). Реципиенты трансплантации гемопоэтических клеток (HCT) очень уязвимы к тяжелым последствиям инфекции RSV с самым высоким риском смерти в течение 100 дней после трансплантации (4).Лицензированная вакцина против RSV еще не доступна из-за проблем со стабильностью, чистотой, воспроизводимостью, переносимостью и эффективностью вакцин-кандидатов (5–8). Более того, пациенты с ослабленным иммунитетом могут не реагировать адекватно на вакцинацию из-за их относительного иммунологического подавления. Текущие стратегии лечения, продемонстрировавшие свою эффективность у пациентов с ослабленным иммунитетом, включают противовирусную терапию, такую ​​как рибавирин, паливизумаб, и иммуномодуляцию с общим ВВИГ (9–11).

    Поверхностный гликопротеин слияния

    RSV (F) представляет собой белок класса I, который опосредует проникновение вируса в клетки-хозяева путем трансформации из метастабильной тримерной конформации до слияния (пре-F) в высокостабильную конформацию после слияния (пост-F).Антигенная топология RSV F существенно изменяется во время этого перехода. Молекулы, которые предотвращают эти структурные изменения, могут предотвратить слияние вирусов и иметь потенциал в качестве терапевтических средств для лечения инфекции RSV. Некоторые группы эпитопов, называемые антигенными сайтами, обычно консервативны как в пре-F, так и в пост-F конформации, тогда как другие обнаруживаются либо в пре-F, либо в пост-F конформации (12). Описано шесть антигенных сайтов белка F: Ø-V. Антигенный сайт Ø («ноль») присутствует на вершине тримера pre-F.Пре-F-специфические антитела (MEDI8897 и D25) распознают антигенный сайт Ø (13). Антигенный сайт I находится в конформации post-F. mAb 131-2A связывается с антигенным сайтом I после подтверждения после F (14, 15). Антигенные сайты II и IV обнаруживаются как в пре-F, так и в пост-F конформации. Паливизумаб (Synagis) — первое охарактеризованное моноклональное антитело (mAb) и в настоящее время единственное mAb, лицензированное для предотвращения тяжелой инфекции RSV у младенцев из группы высокого риска. Он распознает антигенный сайт II. mAb 101F распознает антигенный сайт IV.Хотя элементы вторичной структуры, которые образуют сайт III, присутствуют как в пре-F, так и в пост-F, они принимают различное пространственное расположение в пост-F, что приводит к более высокому сродству связывания с пре-F (16). Было показано, что сильно нейтрализующее mAb MPE8 распознает антигенный сайт III (16). Антигенный сайт V находится в пре-F конформации и расположен между сайтами Ø и III. mAb AM14 нацелено на антигенный сайт V и является сильно нейтрализующим mAb (17, 18).

    RSV — это, прежде всего, ограниченный слизистой оболочкой вирус, вызывающий повреждение верхних и нижних дыхательных путей во время его многократных циклов репликации.Он может вызывать клеточные и гуморальные иммунные ответы на различных уровнях у реципиентов HCT, в зависимости от степени, в которой люди остаются с ослабленным иммунитетом после трансплантации. RSV-специфические нейтрализующие антитела играют важную роль в предотвращении тяжелой инфекции, в то время как клеточные иммунные ответы, как полагают, играют важную роль в разрушении инфицированных RSV клеток и, таким образом, излечении инфекции. Ранее не получавшие RSV, но иммунокомпетентные младенцы могут выделять RSV из верхних дыхательных путей (URT) в течение до 21 дня; Напротив, дети с ослабленным иммунитетом могут выделять RSV в течение нескольких месяцев (19, 20).В мышиной модели RSV-инфекции CD8 + T-клетки способны устранять RSV-инфекцию (14, 21–23). Ограниченные данные исследований младенцев с первичной инфекцией RSV предполагают, что клеточный иммунный ответ со специфическими цитотоксическими Т-лимфоцитами запускается в течение 10 дней после инфицирования (24, 25). Сообщалось об исследованиях гуморальных иммунных ответов после первичной инфекции RSV у детей и повторной инфекции у детей и взрослых (26–28). Хотя введение внутривенного иммуноглобулина (ВВИГ) с высокой активностью нейтрализующих антител против РСВ и паливизумаба обеспечивает защиту от тяжелой инфекции РСВ у младенцев из группы высокого риска, роль нейтрализующих антител в выздоровлении от установленной инфекции не ясна.Ранее мы продемонстрировали, что значительно более высокие уровни гуморальных антител, конкурирующих с паливизумабом, и титры нейтрализующих антител связаны с более быстрым клиренсом RSV у реципиентов HCT. Эта когорта из сорока взрослых HCT, инфицированных RSV, дала нам возможность дополнительно изучить уровни конкурентных антител, специфичных к эпитопу RSV, и определить дополнительные иммунные корреляты вирусного клиренса. Были разработаны и стандартизированы еще три анализа конкурентных антител, специфичных к эпитопу RSV, для обнаружения конкурентных антител к антигенным сайтам Ø, I и IV.Кроме того, понимание взаимосвязи между нейтрализующими антителами и эпитопной специфичностью конкурентных антител, вызванных в ответ на естественную инфекцию RSV, будет иметь решающее значение при выборе и разработке новых моноклональных антител и вакцин для предотвращения RSV.

    Методы

    Объекты исследования

    реципиентов HCT с лабораторно подтвержденной инфекцией верхних дыхательных путей RSV при включении и отрицательными результатами рентгенографии грудной клетки были зарегистрированы в течение 72 часов после диагностики RSV и стратифицированы по уровню риска прогрессирования в нижние дыхательные пути, как описано ранее (29).С января 2012 г. по апрель 2015 г. у всех пациентов собирали сыворотку при включении (острый) и через 14–60 дней после госпитализации (в выздоравливающем) для оценки гуморального иммунного ответа. Образцы смыва из носа были собраны при регистрации на 7-й день (± 1), 14-й день (± 1) и между 21-м и 28-м днем ​​(± 1) для обнаружения вирусов в подтипах RSV / A и RSV / B с помощью реальных время, полимеразная цепная реакция с обратной транскрипцией (ОТПЦ-ПЦР). При зачислении было проведено интервью для получения исторической информации, а медицинские записи были просмотрены для извлечения демографических и клинических данных.Институциональные наблюдательные советы онкологического центра им. М. Д. Андерсона и Медицинского колледжа Бейлора Техасского университета одобрили протокол исследования, и все участники получили письменное информированное согласие.

    Полимеразная цепная реакция с обратной транскрипцией в реальном времени (rtRT-PCR)

    Экстракция вирусной РНК и обнаружение RSV / A и RSV / B в образцах смыва из носа с помощью rtRT-PCR в сертифицированной CLIA лаборатории диагностики респираторных вирусов (CLIA ID # 45D0

    6) выполняли, как описано ранее (30).

    Анализы конкурентных антител на антигенных сайтах

    Четыре анализа конкурентных антител по антигенным сайтам были использованы для измерения концентраций D25-конкурирующего антитела (сайт Ø), 131-2A-конкурирующего антитела (сайт I), конкурирующего с паливизумабом антитела (сайт II) и 101F-конкурирующего антитела (сайт IV) в сыворотке, которые конкурируют с биотинилированными mAb за связывание с соответствующим антигенным сайтом слитого белка RSV. D25 и 101F были приобретены в Cambridge Biologics, LLC, Brookline, MA, USA.Паливизумаб был от MedImmune, LLC, Гейтерсбург, Мэриленд, США. 131-2A был от EMD Millipore Corporation, Темекула, Калифорния, США. mAb биотинилировали с помощью набора для биотинилирования антител Pierce TM (Pierce, Rockford, IL, USA) в соответствии с инструкциями производителя. Источником слитого белка был RSV / A / Bernett, очищенный сахарозой (spRSV, GA1) для сайтов I, II и IV. Сто мкл spRSV (общий белок 7 мкг / мл) наносили на 96-луночный планшет Immulon 2HB (Thermo Scientific, Waltham, MA, USA) на 18 ч при 4 ° C.Для конкурентного анализа антител на участке Ø 100 мкл суспензии клеток HEp-2 (24 x 10 4 клеток / мл) в 10% FBS / MEM высевали на 96-луночные планшеты для культивирования тканей Falcon от Corning (Питтстон, Пенсильвания, США. ). Планшеты инкубировали при 37 ° C с 5% CO 2 и влажностью 85% в течение 24 часов с образованием монослоев. Клетки инокулировали spRSV (MOI = 0,002) и инкубировали в тех же условиях в течение 2 дней. Планшеты для всех четырех анализов блокировали на 1 час 5% -ным молоком (Carnation Instant Nonfat Dry Milk) в однократном фосфатно-солевом буфере.Сто мкл D25, 131-2A, паливизумаба и 101F в концентрации 1,25 мкг / мл в 5% молоке (для 131-2A, паливизумаба и 101F) и 5% молока в 10% определенной фетальной бычьей сыворотке в минимальном количестве Эфирную среду (для D25) добавляли в двух экземплярах с последующими 2-кратными серийными разведениями (от 12500 до 24,41 нг / мл) для построения стандартной кривой на каждом планшете. Следующие 50 мкл 2-кратных серийных разведений образцов сыворотки (от 1: 5 до 1: 2,560) в двух экземплярах добавляли в покрытые планшеты, а затем сразу же 50 мкл 100 нг / мл биотинилированных mAb (D25, 131-2A, palivizumab и 101F), полученный с помощью набора для биотинилирования антител Pierce TM (Pierce, Rockford, IL) в соответствии с инструкциями производителя, с последующей инкубацией в течение 1 часа.После промывки добавляли стрептавидин, конъюгированный с HRP (SeraCare Life Sciences, Gaithersburg, MD), на дополнительный час. Лунки, содержащие биотинилированное mAb без сыворотки, служили положительным контролем, представляющим максимальное связывание. Лунки без биотинилированных mAb, содержащие либо 5% молока вместо сыворотки, либо лунки, содержащие сыворотку, служили отрицательными контролями. Модель регрессии с четырьмя параметрами логистической (4PL) была использована для расчета конкурентных концентраций антител (мкг / мл) на основе динамического диапазона стандартной кривой путем интерполяции концентрации стандартов, которая соответствует значению поглощения, при котором исследуемая сыворотка образец привел к 50% ингибированию.Нижний предел обнаружения (LLoD) составлял 1,0 мкг / мл для конкурентных анализов антител в сайтах I, II и IV и 7,8 мкг / мл для конкурентных тестов антител в сайтах Ø. Образцам с концентрацией ниже LLoD было присвоено значение 0,5 и 3,9 мкг / мл соответственно.

    Анализ специфической микронейтрализации белка (MN) RSV F

    Образцы сыворотки и четыре mAb (D25, 131-2A, паливизумаб и 101F) были проанализированы на нейтрализующие антитела (Nt Ab) против RSV / A / Tracy и RSV / B / 18537 в клетках HEp-2 с использованием квалифицированного анализа микронейтрализации. как описано ранее (31–33).Образцы сыворотки и mAb (конечная концентрация составляла 40 мкг / мл) сначала разводили 1: 8 с последующим 2-кратным серийным разведением. Равный объем RSV / A Tracy или RSV / B 18537 добавляли к каждому разведению и инкубировали при 36 ° C с 5% CO 2 в течение 90 минут. Сто мкл клеток HEp 2 добавляли в каждую лунку 96-луночного планшета и инкубировали в течение 6–7 или 7–8 дней для анализов микронейтрализации RSV / A и RSV / B соответственно. Затем 96-луночные планшеты фиксировали и окрашивали раствором 10% формалин / 0,01% кристаллический фиолетовый в течение ~ 24 часов.После того, как 96-луночные планшеты были высушены на воздухе, они были прочитаны. Титры нейтрализующих антител определяли как конечное разведение, при котором наблюдалось 50% снижение вирусного цитопатического эффекта (CPE). Любому образцу сыворотки, дающему титр

    Статистический анализ

    Для демографических характеристик и клинических исходов были проанализированы непрерывные переменные и категориальные переменные.Парный тест t использовали для определения того, значительно ли различались геометрические средние титра нейтрализующих антител (GMT) (log2) или среднее геометрическое логарифмически трансформированных конкурентных концентраций антител (GMC) между образцами в острой стадии и в выздоравливающих. Тест с двумя образцами t использовался, чтобы определить, значительно ли различались концентрации нейтрализующих антител (log2) или GMC логарифмически трансформированных конкурентных антител между пациентами, инфицированными RSV / A и RSV / B, а также между реципиентами HCT, которые выделяли вирус. для <14 и ≥ 14 дней.Статистическая значимость была указана для p -значений <0,05. Коэффициенты корреляции Пирсона были рассчитаны между титрами нейтрализующих антител и сайт-специфическими конкурентными концентрациями антител. Статистический анализ выполняли с использованием SPSS Statistic 22 (IBM, Армонк, Нью-Йорк).

    Результаты

    Демографические и клинические параметры HCT взрослых, инфицированных RSV, были сопоставимы между исследовательскими группами

    Клинические характеристики при зачислении суммированы для всех 40 взрослых HCT в таблице 1 из предыдущей публикации (29), стратифицированной по продолжительности выделения RSV (<14 или ≥14 дней) или по подтипу инфекции RSV (RSV / A или RSV / B). .Вкратце, все перечисленные переменные были сопоставимы между группами. Единственная наблюдаемая значительная разница заключалась в том, что реципиенты, которые выделяли RSV в течение ≥14 дней, с большей вероятностью получили трансплантат аллогенных стволовых клеток по сравнению с реципиентами с более короткой продолжительностью выделения вируса (18/20 против 11/20, p <0,025 ). Абсолютное количество нейтрофилов и абсолютное количество лимфоцитов находятся в пределах нормы для этих когорт. Среднее время от трансплантации до инфицирования RSV составляет 169 и 100 дней для взрослых, выделяющих RSV из URT в течение <14 и ≥14 дней, соответственно.

    Таблица 1 . Уровни антител к RSV в сыворотке крови больных острой фазой и в период выздоровления взрослых HCT, инфицированных RSV

    Тесты на сайт-специфические конкурентные антитела были специфичными к соответствующим конкурентным антителам

    Специфичность четырех конкурентных анализов антител была подтверждена с использованием панели моноклональных антител (12,5 мкг / мл) для конкуренции с биотинилированным моноклональным антителом, специфичным к их соответствующим антигенным сайтам (рис. 1). Используя 125-кратную более высокую концентрацию, панель моноклональных антител, которые связывались с антигенными сайтами белка F, отличными от сайта, на который нацелено биотинилированное моноклональное антитело, не могла ингибировать связывание биотинилированного моноклонального антитела с его антигенным сайтом.Например, D25 ингибировал биотинилированный D25 или конкурировал с ним в анализе конкурентных антител по сайту Ø, в то время как остальные моноклональные антитела в панели не ингибировали связывание биотинилированного D25 с сайтом Ø.

    Рисунок 1 . Специфичность тестов на антигенные сайт-специфические конкурентные антитела против RSV. Синий указывает на отсутствие ингибирования mAb в отношении биотинилированных mAb, специфичных к антигенному сайту RSV. Красный цвет указывает на сильное ингибирование антигенного сайта RSV.Шкала 0,0–1,5 представляет уровень ингибирования mAb от самого сильного до самого слабого. ПВЗ, паливизумаб; МВА, мотавизумаб. Представленные данные получены из 3 независимых дублирующих конкурентных анализов антител.

    Моноклональные антитела с разными уровнями нейтрализующей активности

    Нейтрализующую активность моноклональных антител в концентрации 40 мкг / мл оценивали в анализах микронейтрализации RSV / A и RSV / B (рис. 2). MAb D25, которое связывает антигенный сайт Ø, является наиболее сильным из mAb, используемых в конкурентных анализах антител.Паливизумаб и 101F mAb, которые связывают сайт II и сайт IV, соответственно, обладают умеренной нейтрализующей активностью антител, а 131-2A, mAb сайта I, не обладают измеряемой нейтрализующей активностью, что согласуется с ранее сообщенными результатами (34).

    Рисунок 2 . Нейтрализующая сила антигенного сайт-специфического моноклонального антитела RSV. В экспериментах использовали RSV / A Tracy и RSV / B 18537. Концентрация mAb составляла 40 мкг / мл для D25, паливизумаба, 131-2A и 101F как в анализах микронейтрализации RSV / A, так и RSV / B, за исключением того, что mAb 131-2A использовали при 1.0 мг / мл в анализе микронейтрализации RSV / B. По оси Y показаны титры нейтрализующих антител RSV / A Tracy или RSV / B 18537 (log2) для различных mAb, используемых в анализе микронейтрализации. Представленные данные получены из 3 независимых дублирующих анализов микронейтрализации ± стандартное отклонение.

    Сыворотка выздоравливающих сывороток имела более высокую концентрацию сайт-специфичных конкурирующих или нейтрализующих антител, чем сыворотка острой сыворотки

    Значительное увеличение уровней антител к RSV (конкурентных и нейтрализующих антител) в сыворотке выздоравливающих по сравнению с сывороткой острой фазы было измерено всеми четырьмя конкурентными анализами антител и обоими анализами микронейтрализации (Таблица 1).GMC антитела, конкурирующего с D25 (таблица 1), была самой высокой как в сыворотке крови острой стадии, так и в сыворотке выздоравливающих, за ней следовали 101F-конкурирующее антитело (сайт IV), конкурирующее с паливизумабом антитело (сайт II) и 131-2A-конкурирующее антитело (сайт I) антитела. GMTs нейтрализующих антител RSV / A и RSV / B были сопоставимы. Однако кратное увеличение концентрации конкурентных антител было наибольшим для антител, конкурирующих с паливизумабом (5.6), и наименьшим — для конкурирующих антител с D25 (2.6). Кратное увеличение титров нейтрализующих антител RSV / A и RSV / B было сопоставимым (6.5).

    Более высокие уровни антител были обнаружены у взрослых с HCT, выделяющих RSV

    <14 дней

    Конкурентное антитело в GMC (мкг / мл) и нейтрализующее антитело в GMT (log2) сравнивали между взрослыми HCT, выделяющими вирус из своего URT в течение <14 и ≥14 дней (таблица 2). Что касается сывороток острой фазы, не было значительных различий между двумя группами ни для сайт-специфических конкурентных антител, ни для RSV-специфических нейтрализующих антител. Однако для сывороток выздоравливающих значительно более высокие уровни (<0.01) были обнаружены как сайт-специфические конкурентные антитела, так и RSV-специфические нейтрализующие антитела у взрослых HCT, выделяющих RSV <14 дней, за исключением конкурентного антитела по сайту Ø. Кроме того, все сыворотки выздоравливающих имели более высокие уровни антител, чем сыворотки острой фазы, как для сайт-специфических конкурентных антител, так и для RSV-специфических нейтрализующих антител. Общий GMC для четырех конкурентных антител в сыворотках выздоравливающих увеличился примерно в 5 раз для взрослых HCT, выделяющих вирус <14 дней, и примерно в 2 раза.5 раз для тех, кто выделяет вирус ≥14 дней. Для взрослых HCT, выделяющих вирус <14 дней, общий GMC четырех сайт-специфических антител увеличился с 47,4 мкг / мл в сыворотке острого заболевания до 228,6 мкг / мл в сыворотке выздоравливающих. Для взрослых HCT, выделяющих вирус в течение ≥14 дней, общий GMC увеличился с 34,1 мкг / мл в сыворотке острой фазы до 91,8 мкг / мл в сыворотке выздоравливающих.

    Таблица 2 . Уровни антител к RSV между инфицированными RSV HCT взрослыми, которые передавали RSV <14 дней и ≥14 дней.

    Доля вклада GMC каждого сайт-специфичного конкурентного антитела в общий GMC для сывороток в острой стадии и в период выздоровления от взрослых HCT, выделяющих вирус <14 дней и ≥14 дней, проиллюстрирована на Рисунке 3.Для взрослых HCT, выделяющих вирус <14 дней, ~ 60% общего GMC составлено антителом, конкурирующим с D25, и снижается до ~ 30% в сыворотках выздоравливающих; в то время как процентное содержание 131-2A, антител, конкурирующих с паливизумабом, и антител, конкурирующих с 101F, увеличилось. Для взрослых HCT, выделяющих вирус в течение ≥14 дней, ~ 70% от общего количества GMC также составляли антитела, конкурирующие с D25, в сыворотке крови острой фазы, и процентный вклад четырех конкурентных антител не увеличивался, даже несмотря на то, что общий GMC увеличился с 34.От 1 мкг / мл в сыворотке острой фазы до 91,8 мкг / мл в сыворотке выздоравливающих.

    Рисунок 3 . Процент GMC каждого антигенного сайт-специфического конкурентного антитела против RSV (мкг / мл) к общему GMC (мкг / мл) для сывороток в острой стадии и в период выздоровления от взрослых HCT, выделяющих вирус <14 дней и ≥14 дней. Ось Y представляет собой процентное соотношение GMC каждого конкурентного антитела к общему количеству GMC. Ось X - это типы сывороток: сыворотки в острой стадии или в период выздоровления от взрослых HCT, выделяющих вирус <14 дней или ≥14 дней.Общий GMC был суммой 4 конкурентных GMC антител. Процент каждого конкурентного антитела был равен делению GMC конкурентного антитела на общий GMC. GMC, средняя геометрическая концентрация. N = 40 в каждом конкурентном анализе антител.

    Не наблюдалось значимых различий в уровнях антител в сыворотке крови острой фазы и выздоравливающей крови между HCT взрослых, инфицированных RSV / A, по сравнению с RSV / B

    Сайт-специфическое конкурентное антитело GMC и нейтрализующее антитело GMT сравнивали у взрослых HCT, инфицированных RSV / A и RSV / B (таблица 3).Не наблюдалось значительных различий как в уровне нейтрализующих антител, так и в концентрациях сайт-специфических конкурентных антител в сыворотке крови острой стадии и выздоравливающей крови между взрослыми HCT, инфицированными RSV / A, по сравнению с RSV / B. Повышение активности антител было обнаружено в сыворотках выздоравливающих взрослых HCT, инфицированных RSV / A и RSV / B, с помощью всех 6 анализов. Кроме того, общие GMC 4 конкурентных антител были сопоставимы (133,6 против 159,9 мкг / мл) в сыворотках выздоравливающих у взрослых HCT, инфицированных RSV / A и RSV / B.Это наблюдение согласуется с тем, что антигенные сайты II и IV хорошо консервативны среди изолятов RSV в подгруппах RSV / A и RSV / B.

    Таблица 3 . Уровни антител к RSV между HCT, инфицированными RSV / A и RSV / B.

    Пропорция вклада GMC каждого сайт-специфичного конкурентного антитела в общий GMC для взрослых HCT, инфицированных RSV / A и B, проиллюстрирована на рисунке 4. Конкурирующее с D25 антитело составляет ~ 60% от общего GMC в сыворотке острой фазы для как RSVA, так и B инфицировали взрослых HCT и снизились до ~ 50% в сыворотке выздоравливающих; в то время как процентное содержание 131-2A, антител, конкурирующих с паливизумабом, и антител, конкурирующих с 101F, увеличивалось в сыворотках выздоравливающих взрослых пациентов, инфицированных HCT как A, так и B.

    Рисунок 4 . Процент GMC каждого сайт-специфического конкурентного антитела против RSV (мкг / мл) к общему GMC (мкг / мл) для взрослых HCT, инфицированных RSV / A и B. GMC, средняя геометрическая концентрация. n = 40 в каждом конкурентном анализе антител.

    Сайт-специфические конкурирующие антитела коррелируют со специфическими нейтрализующими антителами к RSV

    Коэффициент корреляции

    Пирсона был рассчитан для измерения силы линейной связи между сайт-специфическими конкурентными антителами и RSV-специфическими нейтрализующими антителами.Мы наблюдали значительную положительную корреляцию между сайт-специфическими конкурентными антителами, измеренными с помощью четырех тестов сайт-специфических конкурентных антител, и нейтрализующими антителами, измеренными тестами микронейтрализации RSV / A и RSV / B. Коэффициенты корреляции варьировались от 0,33 до 0,83 для сывороток острой фазы и от 0,50 до 0,88 для сывороток выздоравливающих, при этом все корреляции были значимыми ( p <0,05) (рис. 5). Наибольшая корреляция наблюдалась между концентрацией антител, конкурирующих с 101F в сайте IV, и титрами антител, нейтрализующих RSV, а самая низкая корреляция наблюдалась между концентрацией антител, конкурирующих с сайтом Ø D25, и титрами антител, нейтрализующих RSV, у взрослых HCT, инфицированных RSV.

    Рисунок 5 . Корреляция антигенного сайт-специфического конкурентного антитела против RSV и нейтрализующего антитела, специфичного к RSV. Коэффициент корреляции Пирсона был рассчитан для измерения силы линейной связи. Коэффициенты корреляции варьировались от 0,33 до 0,83 для сывороток острого заболевания и 0,50–0,88 для сывороток выздоравливающих. * Корреляция значима на уровне 0,05 (двусторонний). ** Корреляция значима на уровне 0,01 (двусторонний). n = 40 в каждом конкурентном анализе антител и анализе микронейтрализации.

    Обсуждение

    Углубленное понимание реакции антител человека на инфекцию RSV поможет в разработке и оценке вакцин и терапевтических средств против болезни RSV. В предыдущих исследованиях сообщалось об эпитопах, нацеленных на RSV-специфические нейтрализующие антитела в сыворотке крови человека (35, 36), а также сообщалось о специфичности и функциональных свойствах антител, вызванных естественной инфекцией RSV (17). Насколько нам известно, настоящее исследование является первым, которое описывает сайт-специфические конкурентные ответы антител на пре-F и пост-F конформации и коррелирует эти сайт-специфические конкурентные ответы антител с вирусным клиренсом и нейтрализующими реакциями антител в HCT, естественно инфицированных RSV. Взрослые.

    В этом проспективном когортном исследовании конкурентные антитела пре-F и пост-F были выявлены после инфицирования RSV у взрослых HCT. Наивысшая концентрация сайт-специфических конкурентных антител в сыворотке острой фазы была против сайта Ø в пре-F конформации, что согласуется с ранее опубликованными результатами, показывающими, что префузионные F-специфические антитела преобладают в поликлональных нейтрализующих антисыворотках (36). Однако высокие уровни сайт-специфических конкурентных антител, присутствующих в группе ≥14 дней, были неэффективными для удаления вируса после того, как вирусная инфекция была установлена.Ngwuta et al. (36) использовали методы, основанные на абсорбции, для определения нейтрализующей активности, связанной с пре-F и пост-F конформациями, а также с сайтом Ø и сайтом II. Наши сайт-специфические конкурентные тесты антител измеряли концентрацию сайт-специфичных конкурентных антител, но не демонстрировали напрямую нейтрализующей активности антигенных сайт-специфичных конкурирующих антител. В целом, антитела, специфичные к RSV, играют важную роль в предотвращении инфекции и меньшую роль в выведении вирусов.Группа, которая избавилась от вируса менее чем за 14 дней, была способна вызвать более сильный гуморальный ответ, вероятно, отражающий большее иммунологическое восстановление после трансплантации стволовых клеток. Хотя мы не измеряли клеточно-опосредованный иммунитет, весьма вероятно, что у этой группы также был более устойчивый клеточный иммунный ответ, который способствовал улучшению вирусного клиренса.

    Сайт I имел самую низкую концентрацию конкурентных антител, что также согласуется с результатами, опубликованными Гилманом и другими (17, 37).Наибольшее кратное увеличение было обнаружено против сайта II, что позволяет предположить, что после инфицирования RSV иммунный ответ распознает другие антигенные сайты, которые не являются уникальными для пре-F формы. Это было продемонстрировано увеличением доли GMC конкурентного антитела сайта II, сайта IV и сайта I, но не сайта Ø, к общему GMC в сыворотках выздоравливающих взрослых HCT, которые быстро избавились от вирусной инфекции. Неясно, почему антитела, которые нацелены на сайты, уникальные для формы pre-F, по-видимому, сохраняются в течение более длительного времени по сравнению с сайтами, общими для форм pre-F и post-F.Важно отметить, что большинство конкурентных антител было направлено на сайт Ø в образцах сыворотки острой фазы. Если бы подобное увеличение концентрации произошло в четырех антигенных сайтах в образцах сыворотки выздоравливающих, это привело бы к более высокому увеличению доли сайт-специфических конкурентных антител, которые имели более низкую концентрацию в образцах сыворотки острой фазы, таких как сайты II и IV. Изменение пропорции сайт-специфических конкурентных антител усугублялось более высоким LLoD (7.8 мкг / мл) для конкурентного анализа антител Ø клеточного сайта, который был значительно выше по сравнению с LLoD (1,0 мкг / мл) для других трех конкурентных тестов антител.

    Мы использовали корреляцию Пирсона для определения связи между четырьмя сайт-специфическими конкурентными антителами и между концентрациями сайт-специфических антител и титрами нейтрализующих антител. Наибольшая корреляция с уровнями нейтрализующих антител, специфичных к RSV, наблюдалась с сайтами II и IV конкурентных антител.Эти результаты предполагают, что антитела против паливизумаба и эпитопов 101F ответственны за значительную часть вирусной нейтрализующей способности сывороток. Это также предполагает, что сайт-специфические конкурентные анализы антител измеряют изменения, которые напрямую связаны с изменениями уровней нейтрализующих антител. Более низкая корреляция, обнаруженная между концентрациями конкурентных антител в антигенном сайте Ø и титрами нейтрализующих антител, может быть связана с тем, что антигенный сайт Ø является наименее консервативной областью по сравнению с другими антигенными сайтами в белке F (13, 38, 39), хотя это не анализировалось. в данном исследовании.Низкая корреляция также может быть связана с относительно высоким LLoD конкурентного анализа антител по сайту Ø по сравнению с более низким LLoD для других трех сайт-специфичных конкурентных тестов антител. Кроме того, небольшие изменения в концентрации конкурентных антител в антигенном сайте Ø могут быть связаны с более значительными изменениями в активности нейтрализующих антител, что затрудняет обнаружение сильной корреляции из-за вариабельности анализа. Из четырех mAb, которые мы тестировали на нейтрализующую активность антител, mAb D25, нацеленное на сайт Ø, было наиболее сильным из mAb, за ним следовали 101F и паливизумаб; 131-2A не проявляет нейтрализующей активности, что согласуется с тем, что сообщили Phung и другие (40).Эти различные активности нейтрализующих антител предполагают, что сайты Ø, II и IV являются основной мишенью реакции нейтрализующих антител человека, а антигенный сайт I не является основной мишенью. Интересно, что несмотря на наличие сильной корреляции между концентрацией конкурентных антител по сайту I и титрами RSV-специфических нейтрализующих антител, mAb по сайту I (131-2A) не проявляли детектируемой активности нейтрализующих антител. Наблюдаемая прямая корреляция, вероятно, отражает способность взрослых HCT вызывать эффективный гуморальный ответ на антигенные сайты белка F, а не механистическую корреляцию между концентрацией конкурентных антител в сайте I и нейтрализующей активностью антител.

    Влияние инфекции RSV по подгруппам вирусов (RSV / A и RSV / B) на гуморальные иммунные ответы на четыре антигенных сайта оценивалось в этом проспективном когортном исследовании. Не наблюдалось значительных различий как в уровне нейтрализующих антител, так и в концентрациях сайт-специфических конкурентных антител, измеренных между реципиентами HCT, инфицированными RSV / A, по сравнению с RSV / B. Кроме того, пропорция и общий GMC четырех конкурентных антител были сопоставимы в сыворотках выздоравливающих между взрослыми HCT, инфицированными RSV / A и RSV / B.Это наблюдение согласуется с тем, что антигенный сайт II и сайт IV хорошо консервативны между подгруппами RSV / A и RSV / B, и предполагает, что моновалентная вакцина RSV-F против инфекции RSV / A и RSV / B, вероятно, достаточна для защиты от тяжелого RSV. болезнь.

    У нашего исследования есть некоторые ограничения. Небольшое количество взрослых HCT, инфицированных RSV ( n = 40), не является репрезентативным для взрослых в общей популяции. У здоровых взрослых может наблюдаться более высокий рост конкурентной концентрации антител и титра нейтрализующих антител после инфицирования RSV по сравнению со взрослыми HCT.Кроме того, мы не измеряли концентрацию конкурентных антител к сайту III и сайту V, оставшимся антигенным сайтам пре-F. Таким образом, их вклад в активность нейтрализующих антител после инфицирования RSV не был определен в этой когорте взрослых HCT, инфицированных RSV.

    Таким образом, исследование выявило значительно более высокие концентрации сайт-специфических конкурентных антител F RSV (за исключением сайта Ø) у взрослых HCT, которые выделяли RSV <14 дней, по сравнению с ≥14 днями, сопоставимые концентрации конкурентных антител в сыворотках выздоравливающих между RSV / A и RSV / B инфицированные взрослые, инфицированные HCT, и значимая положительная корреляция между сайт-специфическими конкурентными антителами и активностью RSV-специфических нейтрализующих антител.В заключение, у взрослых HCT, инфицированных RSV естественным путем, сайт-специфические конкурентные ответы антител возникали на антигенных сайтах, обнаруженных как в конформациях F до слияния, так и после слияния, и были связаны с вирусным клиренсом. Данные могут предполагать, но не демонстрируют, что эти ответы антител способствуют наблюдаемому более быстрому выведению вируса. Более быстрое очищение у людей с более высокими реакциями антител может просто отражать уровень иммунной компетентности этих людей.Таким образом, наблюдаемая связь между более высокими ответами антител и более быстрым клиренсом не обязательно является причиной и следствием. Кроме того, необходима дальнейшая оценка того, как опосредованные Т-клетками ответы способствуют выведению вируса RSV. Наконец, реципиенты HCT, вероятно, выиграют от иммунопрофилактики моноклональными антителами или вакцины RSV-F, если они лицензированы для предотвращения тяжелой инфекции RSV в период их уязвимости после трансплантации.

    Доступность данных

    Наборы данных, созданные для этого исследования, доступны по запросу соответствующему автору.

    Заявление об этике

    Это исследование было проведено в соответствии с рекомендациями институциональных наблюдательных комиссий Центра рака Андерсона Университета Техаса и Медицинского колледжа Бейлора с письменного информированного согласия всех субъектов. Все субъекты дали письменное информированное согласие в соответствии с Хельсинкской декларацией. Протокол был одобрен онкологическим центром доктора медицины Андерсона Техасского университета и медицинским колледжем Бейлора.

    Авторские взносы

    XY, RC и PP разработали исследование.XY, OI, VA, LA, TM и PP выполнили исследование. XY, LF-S и PP проанализировали данные. DS и RC предоставили образцы. КП обработал образцы. Текст редактировали F-AP, VA, LA, TM, LF-S, KP, DS, RC и PP. XY написал первый черновик рукописи.

    Заявление о конфликте интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

    Благодарности

    Авторы высоко ценят Dr.Barney S. Graham, M.D., Ph.D (Лаборатория вирусного патогенеза, NIAID / VRC, NIH Bethesda, MD) за предоставление этих mAb D25 и AM14 против антигенных сайтов во время разработки анализа. Авторы признают вклад рецензентов в улучшение качества представления рукописи. Авторы признают возможность устного представления данных на 11-м Международном симпозиуме по респираторно-синцитиальному вирусу в 2018 г. в Эшвилле, штат Северная Каролина, США.

    Список литературы

    1. Цой Дж. Х., Чой Э., Канг Х. Дж., Парк К. Д., Парк С. С., Шин Х. Ю. и др.Респираторные вирусные инфекции после трансплантации гемопоэтических стволовых клеток у детей. J Korean Med Sci. (2013) 28: 36–41. DOI: 10.3346 / jkms.2013.28.1.36

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    2. Ло М.С., Ли Г.М., Гунавардане Н., Бурчетт С.К., Лахенауэр С.С., Леманн Л.Е. Воздействие RSV, аденовируса, гриппа и парагриппа у педиатрических пациентов, получающих трансплантацию стволовых клеток, трансплантацию твердых органов или химиотерапию рака. Педиатр-трансплант .(2013) 17: 133–43. DOI: 10.1111 / petr.12022

    CrossRef Полный текст | Google Scholar

    3. Анак С., Атай Д., Унувар А., Гарипардич М., Агаоглу Л., Озтюрк Г. и др. Вспышка респираторно-синцитиальной вирусной инфекции среди педиатрических пациентов с онкологическими заболеваниями и / или BMT. Pediatr Pulmonol. (2010) 45: 307–11. DOI: 10.1002 / ppul.21184

    CrossRef Полный текст | Google Scholar

    4. Аснер С., Стивенс Д., Педулла П., Ричардсон С.Е., Робинсон Дж., Аллен У. Факторы риска и исходы инфекций, связанных с респираторно-синцитиальным вирусом, у детей с ослабленным иммунитетом. Pediatr Infect Dis J . (2013) 32: 1073–6. DOI: 10.1097 / INF.0b013e31829dff4d

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    6. Ким Х.В., Канчола Дж. Г., Брандт С. Д., Пайлес Г., Чанок Р. М., Дженсен К. и др. Респираторно-синцитиальное вирусное заболевание у младенцев, несмотря на предварительное введение антигенной инактивированной вакцины. Am J Epidemiol. (1969) 89: 422–34.

    PubMed Аннотация | Google Scholar

    7. Munoz FM, Piedra PA, Glezen WP.Безопасность и иммуногенность вакцины слитого белка-2, очищенной от респираторно-синцитиального вируса, для беременных. Вакцина . (2003) 21: 3465–7. DOI: 10.1016 / S0264-410X (03) 00352-9

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    8. Райт П.Ф., Каррон Р.А., Белше Р.Б., Ши Дж.Р., Рэндольф В.Б., Коллинз П.Л. и др. Отсутствие усиленного заболевания респираторно-синцитиальным вирусом дикого типа после получения живых ослабленных респираторно-синцитиальных вирусных вакцин. Вакцина . (2007) 25: 7372–8. DOI: 10.1016 / j.vaccine.2007.08.014

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    9. Ложно AR, Walsh EE. Респираторно-синцитиальная вирусная инфекция у взрослых. Clin Microbiol Rev. (2000) 13: 371–84. DOI: 10.1128 / CMR.13.3.371

    CrossRef Полный текст | Google Scholar

    10. Шиффер И.Т., Кирби К., Санмайер Б., Сторб Р., Кори Л., Бек М. Сроки и тяжесть внебольничных респираторных вирусных инфекций поднимают миелоаблативную трансплантацию гемопоэтических стволовых клеток по сравнению с немиелоаблативной. Haematologica. (2009) 94: 1101–8. DOI: 10.3324 / haematol.2008.003186

    CrossRef Полный текст | Google Scholar

    11. Льюнгман П., Уорд К.Н., Крукс Б.Н., Паркер А., Мартино Р., Шоу П.Дж. и др. Респираторные вирусные инфекции после трансплантации стволовых клеток: проспективное исследование рабочей группы по инфекционным заболеваниям европейской группы по трансплантации крови и костного мозга. Пересадка костного мозга. (2001) 28: 479–84. DOI: 10.1038 / sj.bmt.1703139

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    13.McLellan JS, Chen M, Leung S, Graepel KW, Du X, Yang Y и др. Структура тримерного гликопротеина слияния RSV, связанного с нейтрализующим антителом, специфичным для предварительного слияния. Наука. (2013) 340: 1113–7. DOI: 10.1126 / science.1234914

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    14. Андерсон Дж., Норден Дж., Сондерс Д., Томс Г.Л., Скотт Р. Анализ местных и системных иммунных ответов, индуцированных у мышей BALB / c экспериментальной респираторно-синцитиальной вирусной инфекцией. J Gen Virol. (1990) 71 (Pt 7): 1561–70.

    PubMed Аннотация | Google Scholar

    15. Састре П., Мелеро Дж. А., Гарсия-Баррено Б., Паломо С. Сравнение аффинной хроматографии и адсорбции на рекомбинантных инфицированных клетках вируса осповакцины для истощения антител, направленных против гликопротеинов респираторно-синцитиального вируса, присутствующих в препарате иммуноглобулина человека. J Med Virol. (2005) 76: 248–55. DOI: 10.1002 / jmv.20349

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    16.Корти Д., Бьянки С., Ванцетта Ф., Минола А., Перес Л., Агатик Дж. И др. Перекрестная нейтрализация четырех парамиксовирусов человеческим моноклональным антителом. Природа. (2013) 501: 439–43. DOI: 10.1038 / природа12442

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    17. Гилман М.С., Кастелланос, Калифорния, Чен М., Нгвута Дж.О., Гудвин Э., Мойн С.М. и др. Быстрое профилирование репертуаров антител к RSV из В-клеток памяти естественно инфицированных взрослых доноров. Sci Immunol. (2016) 1: eaaj1879.DOI: 10.1126 / sciimmunol.aaj1879

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    18. Mousa JJ, Kose N, Matta P, Gilchuk P, Crowe JE Jr. Новый нейтрализующий эпитоп, специфичный для конформации перед слиянием, на слитном белке респираторно-синцитиального вируса. Nat Microbiol. (2017) 2: 16271. DOI: 10.1038 / nmicrobiol.2016.271

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    19. Фишаут М., Туберген Д., Макинтош К. Клеточный ответ на респираторные вирусы с особым акцентом на детей с нарушениями клеточно-опосредованного иммунитета. J Pediatr. (1980) 96: 179–86. DOI: 10.1016 / S0022-3476 (80) 80799-2

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    20. Холл С.Б., Пауэлл К.Р., Макдональд Н.Э., Гала С.Л., Менегус М.Э., Суффин С.К. и др. Респираторно-синцитиальная вирусная инфекция у детей с ослабленной иммунной функцией. N Engl J Med. (1986) 315: 77–81. DOI: 10.1056 / NEJM198607103150201

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    21. Бангхам Ч.Р., Кэннон М.Дж., Карзон Д.Т., Асконас Б.А.Цитотоксический Т-клеточный ответ на респираторно-синцитиальный вирус у мышей. J Virol. (1985) 56: 55–9.

    PubMed Аннотация | Google Scholar

    22. Кэннон М.Дж., Опеншоу П.Дж., Асконас Б.А. Цитотоксические Т-клетки уничтожают вирус, но усиливают патологию легких у мышей, инфицированных респираторно-синцитиальным вирусом. J Exp Med. (1988) 168: 1163–8. DOI: 10.1084 / jem.168.3.1163

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    23. Тейлор Г., Стотт Э. Дж., Хейл А. Дж.Цитотоксические лимфоциты в легких мышей, инфицированных респираторно-синцитиальным вирусом. J Gen Virol. (1985) 66 (Pt 12): 2533–8. DOI: 10.1099 / 0022-1317-66-12-2533

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    24. Чиба Й, Хигашидате Й, Суга К., Хондзё К., Цуцуми Х., Огра ПЛ. Развитие клеточно-опосредованного цитотоксического иммунитета к респираторно-синцитиальному вирусу у младенцев после естественной инфекции. J Med Virol. (1989) 28: 133–9.DOI: 10.1002 / jmv.18304

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    25. Айзекс Д., Бангхэм К.Р., МакМайкл А.Дж. Клеточно-опосредованный цитотоксический ответ на респираторно-синцитиальный вирус у младенцев с бронхиолитом. Ланцет . (1987) 2: 769–71. DOI: 10.1016 / S0140-6736 (87) 92502-5

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    26. Рассел С.Д., Унгер С.А., Уолтон М., Шварц Дж. Иммунный ответ человека на респираторно-синцитиальную вирусную инфекцию. Clin Microbiol Rev. (2017) 30: 481–502. DOI: 10.1128 / CMR.00090-16

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    27. Куцая А., Терос-Яаккола Т., Каккола Л., Тойвонен Л., Пелтола В., Варис М. и др. Проспективное клиническое и серологическое наблюдение в раннем детстве выявило высокий уровень субклинической инфекции RSV и относительно высокий уровень повторного инфицирования в течение первых 3 лет жизни. Эпидемиол. Инфекция. (2016) 144: 1622–33. DOI: 10.1017 / S0950268815003143

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    28.Hall CB, Walsh EE, Long CE, Schnabel KC. Иммунитет к респираторно-синцитиальному вирусу и частота повторных инфекций. J Infect Dis. (1991) 163: 693–8. DOI: 10.1093 / infdis / 163.4.693

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    29. Йе Х, Ивучукву О.П., Авадханула В., Айдэян Л.О., Макбрайд Т.Дж., Ферлик-Старк Л.Л., Пьедра, штат Пенсильвания. Сравнение связывания паливизумаб-подобных антител с различными конформациями белка F RSV у инфицированных RSV взрослых реципиентов трансплантата гемопоэтических клеток. J Infect Dis. (2018) 217: 1247–56. DOI: 10.1093 / infdis / jiy026

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    30. Авадханула В., Чемали Р.Ф., Шах Д.П., Гантожи С.С., Аззи Дж.М., Аидеян Л.О. и др. Заражение новым респираторно-синцитиальным вирусом генотипа Онтарио (ON1) у взрослых реципиентов трансплантата гемопоэтических клеток, Техас, 2011–2013 гг. J Infect Dis. (2015) 211: 582–9. DOI: 10.1093 / infdis / jiu473

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    31.Piedra PA, Wyde PR, Castleman WL, Ambrose MW, Jewell AM, Speelman DJ и др. Усиленная легочная патология, связанная с использованием вакцины против респираторно-синцитиального вируса, инактивированной формалином, у хлопковых крыс не является уникальным вирусным явлением. Вакцина. (1993) 11: 1415–23. DOI: 10.1016 / 0264-410X (93)

    -3

    CrossRef Полный текст | Google Scholar

    32. Пьедра П.А., Грейс С., Джуэлл А., Спинелли С., Бантинг Д., Хогерман Д.А. и др. Вакцина из очищенного гибридного белка защищает от заболеваний нижних дыхательных путей во время сезона респираторно-синцитиального вируса у детей с муковисцидозом. Pediatr Infect Dis J . (1996) 15: 23–31. DOI: 10.1097 / 00006454-199601000-00006

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    33. Piedra PA, Hause AM, Aideyan L. Респираторно-синцитиальный вирус (RSV): нейтрализующее антитело, коррелят иммунной защиты. Methods Mol Biol. (2016) 1442: 77–91. DOI: 10.1007 / 978-1-4939-3687-8_7

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    34. Гудвин Э., Гилман М.С., Рэпп Д., Чен М., Нгвута Д.О., Мойн С.М. и др.Младенцы, инфицированные респираторно-синцитиальным вирусом, вырабатывают мощные нейтрализующие антитела, в которых отсутствует соматическая гипермутация. Иммунитет. (2018) 48: 339–349.e5. DOI: 10.1016 / j.immuni.2018.01.005

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    35. Магро М., Мас В., Чаппелл К., Васкес М., Кано О, Луке Д. и др. Нейтрализующие антитела против преактивной формы слитого белка респираторно-синцитиального вируса открывают уникальные возможности для клинического вмешательства. Proc Natl Acad Sci USA. (2012) 109: 3089–94. DOI: 10.1073 / pnas.1115941109

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    36. Ngwuta JO, Chen M, Modjarrad K, Joyce MG, Kanekiyo M, Kumar A, et al. F-специфические антитела перед слиянием определяют степень нейтрализующей активности RSV в сыворотке крови человека. Sci Transl Med. (2015) 7: 309ra162. DOI: 10.1126 / scitranslmed.aac4241

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    37.Widjaja I, Wicht O, Luytjes W., Leenhouts K, Rottier PJM, van Kuppeveld FJM и др. Характеристика эпитоп-специфичных ответов антител против респираторно-синцитиального вируса (анти-RSV) после естественной инфекции и после вакцинации инактивированным формалином RSV. J Virol. (2016) 90: 5965–77. DOI: 10.1128 / JVI.00235-16

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    38. Николс В.Г., Гули Т., Бек М. Внебольничные инфекции, вызванные респираторно-синцитиальным вирусом и вирусом парагриппа, после трансплантации гемопоэтических стволовых клеток: опыт онкологического исследовательского центра Фреда Хатчинсона. Пересадка костного мозга Biol . (2001) 7 (Дополнение): 11S-15S. DOI: 10.1053 / bbmt.2001.v7.pm11777098

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    39. Коннор А.Л., Бевитт Д.Д., Томс Г.Л. Сравнение последовательностей гена слитого гликопротеина А2 респираторно-синцитиального вируса человека и 8/60 и картирование эпитопов антител, специфичных для подгруппы. J Med Virol . (2001) 63: 168–77. DOI: 10.1002 / 1096-9071 (20000201) 63: 2 <168 :: AID-JMV1012> 3.0.CO; 2-U

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    40.Фунг Э., Чанг Л.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *