Выписку из егрип через интернет бесплатно: Как бесплатно получить выписку из ЕГРЮЛ или ЕГРИП | ФНС России

Содержание

Выписки из ЕГРИП, ЕГРЮЛ по инн с сайта налоговой бесплатно

Выписка ЕГРИП – важный документ, нашедший широкое применение в хозяйственной практике. Предоставляется для того, чтобы ИП мог участвовать в торговых сделках, открывать счета в банках, заключать договоры с партнерами. Нет удивления в том, что многие ИП ставят перед собой вопросы касательно того, как заказать выписку из ЕГРИП в налоговой, через интернет или другими доступными методами с минимальной суммой потерь. Рассмотрим основные возможные решения в статье.

Как получить выписку ЕГРИП

Известно несколько вариантов получения выписки:

  1. Можно прийти в ФНС и принести нужную информацию.
  2. Проще всего – сделать процедуру в интернете.
  3. Еще легче – воспользоваться услугами посредника.

Обратите внимание: первый метод, хоть и более затратный по труду, является эффективным, и многие люди, скептически настроенные по отношению к интернету, пользуются им. Второй вариант – также простой, поскольку для его осуществления не придется куда-либо идти.

О процедуре получения выписки

Рассматривая вопрос о том, как получить выписку из ЕГРИП бесплатно через интернет по ИНН, необходимо соблюдать следующие этапы:

  1. Заходим на сайт ФНС.
  2. Создаем новую заявку.
  3. Следим за инструкцией.
  4. Указываем данные: номер записи о регистрации и так далее.
  5. Определяем вид подачи выписки: в интернете, на бумаге.

Пользователь может следить за ходом, в котором происходит обработка заявки, для этого предусмотрен специальный режим. Так, если заявитель сообщает о намерении получить данные исключительно в электронном варианте, то ему дается ссылка, перейдя по которой, будет сформирована выписка в формате Excel. Доступ к ней пользователь имеет в течение 5 дней (рабочих) с момента оформления заявки, затем доступ прекращен, и при необходимости, придется открывать новое заявление.

Выписка ЕГРИП онлайн бесплатно – процедура, требующая осуществить перечень действий. Однако если следовать данной инструкции, процесс не будет представлять собой ничего сложного.

  1. Для этого нужно пройти ряд процедур на сайте, который оказывает государственные услуги, и ввести ИНН в соответствующее поле.
  2. Вводятся символы, подтверждающие отправление запроса требуемым субъектом.
    Непосредственное получение выписки: обычно она выдается в привычном формате PDF. При необходимости документ распечатывается.
  3. Если речь идет об оформлении документации в интернете, то для проведения операции достаточно будет воспользоваться мобильным телефоном. Может быть оформлена выписка не только на этого, но и на любого другого предпринимателя, особенно это актуально в случае совершения партнерской сделки.

Существуют разные варианты получения выписки ЕГРИП

Основные положения

С момента, когда осуществляется непосредственное оформление документации до дня, когда она поступает на руки ИП, должно пройти определенное время. Информация в бумагах обычно полная, однако за эти дни не исключено, что она претерпит некоторые изменения и может утратить актуальность. Что касается сайтов, то их оформление и обновление проводится ежедневно, поэтому есть возможность получения всегда свежих данных.

Недостатки системы ЕГРИП

При подаче в банк для получения кредитования документация ЕГРИП рассмотрению подлежать не будет в силу таких причин, как:

  • отсутствие печати ФНС;
  • минимум юридической силы.

Обратите внимание: скорость, с которой осуществляется получение документации в режиме онлайн, зависит от многих факторов, и в первую очередь – это степень загруженности сайта, а также скорости интернета. Например, в сельской местности процедура затягивается надолго.

Мы уже говорили о том, что документ может содержать несколько недостоверные данные: ведь с сайта нельзя проверить, кто делает запрос, поэтому в некоторых случаях элемент вовсе не будет актуальным.

Проще всего получить выписку по средствам Интернета, но в ней будут отсутствовать важные данные

Последовательность получения выписки

  1. Найти соответствующий сайт, на котором можно получить помощь. Традиционно он открывается на вкладке, в которой представлены данные о ЮЛ.
  2. На этом же сайте нужно выбрать вкладку с названием «ИП/КФХ».
    Запрос на выписку из ЕГРИП по ИНН предполагает ввод номера того предпринимателя, который является получателем. Если эти данные отсутствуют, то требуется искать по фамилии и региону, введя определенный набор данных.
  3. После прохождения всех операций требуется заняться вводом необходимых цифр, выступающих в качестве проверочных.
  4. На странице, которая появится позже, будут указаны результаты поиска. Выбрать графу личных данных и нажать на ссылку, соответствующую вашему ИП. Выписка отобразится на экране в PDF, она может быть распечатана или сохранена.

Преимущества и недостатки системы ЕГРИП

Преимущества:

  • простота и высокая скорость оформления;
  • бесплатное осуществление процедур;
  • всегда актуальная информация;
  • возможность проведения работ в любое время в любом месте;
  • получение документа на сторонних лиц.

Недостатки:

  • выписка не заверяется посредством печати налоговой инспекции, поэтому нотариальная контора или банк ее не примут;
  • возможность получения зависит от того, насколько загруженным является портал, важную роль играет скорость соединения с интернетом;
  • отсутствие полноценных данных и сведений о документе, который удостоверяет личность.

Обратите внимание: что касается бумажного варианта, то выписка ЕГРИП бесплатно может быть получена только в том случае, если берется предпринимателем на только себя. Что касается посторонних лиц, то ее получение обойдется в определенную сумму.

Бумажный вариант выписки ЕГРИП также обладает своими плюсами и минусами. Из положительных моментов нужно отметить, выписка ЕГРИП заверяется налоговой бесплатно и содержит полный перечень данных о получателе.

Из минусов стоит выделить следующие нюансы:

  • чтобы получить бесплатно, важно присутствие самого ИП;
  • потребуется время для подготовки этого вида документа;
  • в сравнении с электронной версией, документ обладает меньшей актуальностью;
  • за срочный вариант потребуется платить государственную пошлину;
  • требуется заниматься заполнением подробного заявления;
  • передается оно в налоговые органы;
  • необходимость посещения налоговой инспекции несколько раз.

Бесплатный заказ выписки

Ранее для проведения процесса приходилось сталкиваться с бюрократическими проблемами, а сегодня эта процедура стала значительно проще. Она может быть по-прежнему получена в органах ФНС, однако если нет возможности прийти в органы, то выписка может быть представлена в электронном варианте на основании запроса.

Чтобы написать заявление на получение выписки из ЕГРИП достаточно взять образец для ИП в налоговой инспекции или на сайте, на котором вы собираетесь делать заявку.

Но есть одно НО: при обычном раскладе подавать заявку может любое юридическое, физическое лицо, а что касается интернета, то сделать это может только сам индивидуальный предприниматель. Бывают и исключения из правил, когда информация выдается другим лицам – руководителям фермерских хозяйств. Но эти люди должны иметь на руках сертификат ключа подписи, который выдается специальным центром.

Ознакомитесь с процессом получения выписки, прежде чем заказывать ее любым из возможных способов

Тонкости заказа выписки

Заказ выписки из ЕГРИП, стоимость которого зависит от ряда факторов, представляет собой сложный процесс. Традиционно там находятся базовые сведения о предпринимателе: ФИО, пол, прописка, гражданство. Если имеет место быть рассмотрение случая с иностранным гражданином, то ключевое требование – предоставление документа, на основании которого он проживает на территории РФ. Отмечается среди данных и идентификационный код ИП.

Мы уже говорили о необходимости документа при открытии счета, взятии кредитных средств или партнерстве. Без выписки предпринимателю невозможно оформить некоторые документы, а также она нужна для оформления сделок с недвижимым имуществом.

Обратите внимание: часто предоставляется возможным получение этого документа за ограниченный период времени, поскольку на основании условий, есть определенные положения. Для предпринимателей важность представляет оперативность, поэтому возможность оформления документа посредством интернета актуальна всегда.

Рассматривая вопрос о том, как получить выписку из ЕГРИП для ИП через интернет –  заказать её  можно бесплатно, не выходя из дома. Дело в том, что в ЕГРИП содержатся данные о любом предпринимателе, не зависимо от сферы его деятельности и времени, в течение которого он занимается ею. В реестре при необходимости можно найти отображенные данные о переформировании ИП, а также о его переквалификации, ликвидации. Выписка несет в себе пользу в многочисленных случаях, поэтому получение выписки из ЕГРЮЛ, ЕГРИП через интернет – важная процедура, требующая особого внимания.

Вам будет предоставлен подробный и достоверный образец заявления на получение выписки из ЕГРЮЛ от юридического лица. На его основании требуется подать заявку и дождаться готового варианта выписки, сделав это за непродолжительное время.

Как получить выписку из ЕГРЮЛ / ЕГРИП через интернет бесплатно?

Как получить выписку из ЕГРЮЛ через интернет бесплатно? Заявление на получение выписки из Единого государственного реестра юридических лиц / Единого государственного реестра юридических лиц можно подать через сайт Федеральной налоговой службы. Документ создается на следующий день после подачи заявки, а услуга предоставляется бесплатно. Информация о компании или индивидуальном предпринимателе, в частности о тех, которые требуются для аккредитации в федеральных EPT, предоставляется в электронном виде.

Законодательный аспект:

В соответствии с ФЗ-129 * «О государственной регистрации юридических лиц и индивидуальных предпринимателей» возможно бесплатное получение информации из Единого государственного реестра юридических лиц / ЕГРЮЛ о конкретной компании или индивидуальном предпринимателе при наличии соответствующих документов. выполняются в электронном формате. Их юридическое значение определено Федеральным законом № 63 ** «Об электронной подписи».

Итак, как получить онлайн-выписку ЕГРЮЛ / ЕГРИП бесплатно? Действия пользователя по шагам:

1. Пройдите процедуру регистрации на nalog.ru

Авторизуйтесь (введите логин и выбранный пароль).

Примечание 1; Если вы получите выписку без авторизации, то электронной подписи от ФНС не будет.

Примечание 2: пользователю не нужен собственный сертификат ключа ЭЦП для получения услуги.

3. Перейдите в раздел на сайте ФНС, где организована служба приема заявок.

Подать заполненное заявление на получение выписки из Единого государственного реестра юридических лиц (ЕГРЮЛ)

Примечание 1: Онлайн-справка ФНС от USRLE будет доставлена ​​не позднее, чем на следующий день после даты подачи заявления. Онлайн-выписка USRLE FNS формируется за аналогичный период времени.

Примечание 2: Для того, чтобы найти декларацию в списке, необходимо указать критерий (ИНН / ОГРН / ОГРНИП) или ранее присвоенный номер.

5. Загрузите готовую выписку, нажав на гиперссылку, которая отобразится в списке запросов после создания документа.

Проблема «достоверность подписи неизвестна»:

Электронная подпись ФНС России находится на последнем листе налоговой декларации. После наведения курсора на окно с текстом: «Подпись 1 Подпись еще не проверена». Причина появления этого сообщения в том, что не были произведены настройки программного обеспечения, необходимые для проверки ЭЦП.

После нажатия на область ЭЦП появляется окно, в котором дополнительно сообщается, что срок действия подписи неизвестен. Чтобы решить эту проблему, пользователям следует обратиться к рекомендациям по проверке электронных подписей в PDF-документах, доступных на веб-сайте.

После настройки параметров информационное окно должно выглядеть так:

Информация для новичков в цифровом бизнесе:

Выписка USRLE (Единый государственный реестр юридических лиц), как и выписка USRLE, имеет широкий спектр применения. Одно из направлений — через аккредитацию на 6 федеральных ЭПЦ. Их список можно найти на портале iEcp.ru (главное меню «rarr;« e-tenders »& rarr;« электронные торговые площадки ») с помощью фильтра.

Примечание 1. Компании и индивидуальные предприниматели, заинтересованные в быстрой аккредитации на ЭТП, должны сообщать в «Сервисы». Единый Портал электронной подписи.

Примечание 2. Пользователи могут увидеть схему прохождения процедуры аккредитации по этой ссылке.

Осторожность. Справка ФНС в формате pdf имеет юридическую силу только в электронном виде; теряет эту функцию после печати.

По сравнению с бумажными аналогами онлайн-выписки ФНС из Единого государственного реестра юридических лиц и онлайн-выписки из Единого государственного реестра юридических лиц имеют ряд преимуществ:

(+) экономия времени — не нужно физически присутствовать в отделении Федеральной налоговой службы и следовать инструкциям «Как бесплатно получить справку ЕГРЮЛ / ЕГРИП онлайн? Занимает не более 3-5 минут; срок изготовления не превышает 2-х суток,

(+) экономия — услуга в электронном виде — бесплатно, в бумажном — платно.

Примечание: для активных участников государственных закупок эти затраты могут стать материальными затратами.

Активное развитие и информирование о возможностях электронных услуг — это перевод все большего количества услуг, в том числе подачи заявлений на получение выписки из Единого государственного реестра юридических лиц / ЕГРЮЛ, с бумажных документов на электронные. Что, несомненно, является положительной тенденцией в процессе становления цифровой экономики.

Как бесплатно получить выписку из ЕГРЮЛ

Вы здесь: Советы Как получить выписку из ЕГРЮЛ онлайн за 6 минут и бесплатно

Юридическому лицу иногда нужно получить документы быстро, в режиме онлайн, например, выписку из ЕГРЮЛ, чтобы сделать это бесплатно и всего за 6 минут, читайте дальше.

 

Когда юридически лица осуществляют юридически значимые действия реорганизация, ликвидация и банкротство, то такие события отражаются в ЕГРЮЛ (Едином государственном реестре юридических лиц).

 

Для получения выписки из единого реестра компании обращаются по привычке в МФЦ или ИФНС. А вы знаете, что есть более быстрый способ?

 

Сейчас вы узнаете как можно получить выписку, снабженную электронной цифровой подписью всего за 6 минут, не верите?

 

Кстати, документ, снабженный электронной подписью, в соответствии с пунктом 1 и 3 статьи 6 Федерального закона № 63 – ФЗ от 6.04.2001 года «Об электронной подписи» по значимости соответствует бумажной выписке, заверенной синей печатью и подписью руководителя налогового органа.

 

Засекайте время!

 

Чтобы получить выписку вам нужно обратиться на сайт Федеральной налоговой службы по адресу www.nalog.ru. На главной странице кликните большую оранжевую кнопку «Все сервисы», в открывшемся списке выберите «Предоставление сведений из ЕГРЮЛ/ЕГРИП о конкретном юридическом лице/индивидуальном предпринимателе в форме электронного документа».

 

Если вы уже авторизованы на этом сайте, войдите, введя свои регистрационные данные (логин, состоящий из e-mail и пароля). Для регистрации нового пользователя, введите в соответствующие поля свой e-mail, придумайте пароль, повторите его, введите имя и фамилию.

 

После ввода данных кликните кнопку «Продолжить», вы увидите сообщение о том, что новый пользователь, то есть вы, успешно зарегистрированы. Для подтверждения вашей регистрации на e-mail будет отправлено письмо, проверьте почту, и подтвердите регистрацию, перейдя по ссылке.

 

Для отправки запроса на оформление выписки в разделе «Предоставление сведений из ЕГРЮЛ/ЕГРИП о конкретном юридическом лице/индивидуальном предпринимателе в форме электронного документа» кликните ссылку «Подать новую заявку».

 

На открывшейся странице введите данные ОГРН компании, для получения выписки из ЕГРЮЛ, кликните кнопку «Сформировать заявку». Выписка формируется в течение 5 (пяти) минут и по окончании процесса вы увидите в поле «Статус заявки» значение «Выписка сформирована».

 

Это значит, вы можете сохранить на свой компьютер документ, подписанный усиленной квалифицированной электронной цифровой подписью ФНС, кликнув ссылку «Скачать выписку».

 

Такая выписка будет активной, то есть ее можно будет скачать, в течение 5 (пяти) дней.

 

Читайте также: Кому будет полезна электронная цифровая подпись

 

Удачи вам, берегите свое время!

Срок действия выписки из Единого государственного реестра юридических лиц. Заявление о выдаче выписки из Единого государственного реестра юридических лиц

Если вам необходимо узнать официальную информацию о юридическом лице, внесенном в единый государственный реестр, то вам потребуется выписка. Его можно получить в налоговой службе, которая с 2002 года стала уполномоченным регистрирующим органом.

Кто и как может взять выписку

Налоговый орган может выдать любому заинтересованному лицу документ, в котором указаны официальные данные хозяйствующего субъекта.Понятно, что чаще всего заявление на выписку из Единого государственного реестра юридических лиц подает само предприятие. Этот документ им нужен при подаче заявлений в Арбитражный суд, для участия в тендерах, аукционах (если планируется выход на муниципальную или государственную службу), при подаче документов на организацию рынка, направление заявки на перевод земель из одной категории в другую и другие случаи. Также эту бумагу подают в банковские учреждения, статистику, регистрационную службу, нотариуса.Для получения официального документа необходимо подать запрос в налоговый орган, оплатить установленную госпошлину и получить на руки выписку с печатью и прошитыми листами.

Но узнать информацию о юридическом лице только о самом предприятии нельзя. Такой запрос может сделать кто угодно, будь то физическое, юридическое или предпринимательское. Предоставленные налоговые данные необходимы, например, для предварительного ознакомления с будущим партнером. Выписку можете получить даже вы как физическое лицо, если, например, собираетесь устроиться на работу в какую-то фирму.Таким образом, вы можете убедиться, что это официально действующее юридическое лицо, которое платит налоги.

Требуется для получения бумаги

Для того, чтобы выйти из официального налогового документа, вам необходимо подать запрос в произвольной форме и приложить подтверждение платежа. В запросе необходимо указать регистрационный номер компании или ИНН. Если эта информация вам не известна, вы можете попытаться узнать из других известных данных. Но при этом учтите, что невозможно идентифицировать информацию об интересующем вас налогоплательщике по имени или (в случае с предприятием) по названию.

Вы можете запросить эту выписку в Едином государственном реестре юридических лиц или отправить ее по почте в любой налоговый орган, уполномоченный предоставлять такую ​​информацию. Если вам нужны копии документов из реестра, то вам достаточно обратиться в службу, обслуживающую интересующий вас хозяйственный объект.

Оформление и получение ценных бумаг

Срок, установленный налоговой службой для получения выписки, не превышает 5 дней, считая с момента получения запроса.При этом с заинтересованного лица необходимо оплатить госпошлину в размере 200 рублей. Но если нет времени ждать, то можно заплатить 400 рублей и заказать выписку из Единого государственного реестра юридических лиц. В этом случае он вам будет предоставлен не позднее следующего рабочего дня для налоговой службы при получении соответствующего запроса.

Документ получен срочно, ничем не будет отличаться от обычного. Только учтите, что вам может быть выдана выписка из Единого государственного реестра юридических лиц (ЕГРИП), копии документов, содержащихся в реестре, либо справка об их отсутствии.Оплата производится за каждый документ. Например, если вам нужно получить несколько заверенных копий, вам придется заплатить за каждую из них. Чтобы правильно рассчитать необходимую сумму, вы можете сначала обратиться в налоговый орган и узнать перечень всех документов, содержащихся в Едином государственном реестре юридических лиц. Такая информация предоставляется бесплатно.

Реквизиты для платежа

Если вы понимаете, как получить выписку из Единого государственного реестра, теперь вам нужно разобраться с оплатой.Чтобы получить необходимую информацию из реестра или копии имеющихся документов, вам необходимо будет предоставить подтверждение оплаты необходимой суммы. В настоящее время это можно сделать двумя основными способами. Так, в налоговой вас могут попросить сформировать платежное поручение. Необходимые подробности вы можете найти на сайте ФНС, они будут различаться в зависимости от местонахождения субъекта.

Кроме того, налоговая служба предоставляет возможность оплаты госпошлины через специальный онлайн-сервис, который обслуживают банки-партнеры.Там вам нужно будет ввести свои личные данные как плательщика, включая ИНН и адрес проживания. В соответствии с этой информацией будет сформирован документ, на основании которого можно будет расплачиваться наличными в любом из банков или осуществлять платежи через всемирную паутину. Правда, для использования последнего способа вам понадобится подключенный интернет-банкинг.

Срок действия документов

Законодательством Федерации установлены временные рамки использования выписки из Единого государственного реестра юридических лиц.Срок, в течение которого можно использовать бумаги, зависит от того, для какой цели они были взяты. Таким образом, налоговое законодательство не устанавливает выписку из Единого государственного реестра юридических лиц. Но нормативные документы, которые в некоторых случаях требуют подачи этого документа, устанавливают временные рамки, в которых он считается действительным. Лучше всего уточнить этот срок непосредственно в органе, в котором будет сдан сертификат.

Например, срок действия выписки из реестра для участия в конкурсах или аукционах, где речь идет о бюджетных деньгах, составляет не более 6 месяцев.Для Арбитражного суда он не превышает 30 календарных дней. Если нотариусу нужна выписка, то срок ее хранения зависит от действий, которые этот специалист должен будет подтвердить. В одних случаях он может не превышать 10, в других — 30 дней, но бывают ситуации, когда это не имеет значения.

Заверение бумаг: при поступлении новых документов в налоговую

Конечно, обо всех ситуациях, в которых важен срок действия выписки из реестра, лучше всего вам расскажет нотариус.Но если у вас нет возможности получить консультацию заранее или вы хотите подготовиться к встрече, то следующая информация будет вам полезна. Если представителю необходимо заниматься отчуждением долей в ООО, и он может ими распоряжаться только на основании дубликата соответствующего заверенного договора, то в данной ситуации срок истечения реестра составляет 10 дней. Только в этом случае нотариус получит право засвидетельствовать сделку. Во всех остальных случаях отзыва части уставного капитала полномочия представителя могут быть подтверждены выпиской не более чем за 30 дней.

При необходимости нотариального заверения других действий, например подтверждения подписи на заявлении о внесении изменений в реестр, срок действия выписки из реестра не ограничен.

Доступ к электронному реестру

В настоящее время индивидуальные предприниматели и предприятия могут не только заказывать заверенные документы за плату в налоговой инспекции. У них есть возможность просматривать интересующую информацию со своего компьютера через Интернет. На сайте налоговой службы представлены все официальные отчеты по каждому субъекту.Любое физическое или юридическое лицо, подавшее соответствующее заявление и оплатившее доступ к базе данных, может просмотреть, скачать и распечатать необходимую информацию. Такая выписка из Единого государственного реестра юридических лиц предоставляется через Интернет при оформлении соответствующих бумаг. Вы можете получить его в любое удобное для вас время. Однако содержащаяся там информация может быть использована только для просмотра и уточнения необходимой информации о компании. Предоставить его в качестве документа в суд или нотариус не получится.

Условно бесплатные услуги

При этом многих интересует, можно ли оформить выписку из реестра бесплатно и можно ли ее просто распечатать. Если вы оплатили доступ к соответствующей базе налоговой службы, то вы сможете беспрепятственно получать необходимую информацию о субъектах хозяйствования. Исключения делаются только для паспортных данных физических лиц, места жительства предпринимателей и информации о счетах.

Но получение таких выписок сложно назвать «бесплатным» способом узнать необходимую информацию, поскольку предварительный доступ к базе данных должен быть платным.Так, на содержание каждого рабочего места отдельно для Единого реестра и для ЕГРИП нужно будет потратить 150 тысяч рублей. Единовременный доступ к реестру будет стоить 50 тысяч рублей. При необходимости для получения обновленной информации придется выложить еще 5 тыс. Руб.

Как подключиться к базе данных

Если в процессе деятельности вам часто приходится узнавать информацию о многих предприятиях, то вам проще один раз подключиться к реестру и посмотреть всю актуальную информацию в тот момент, когда она станет Вам интересно.В этом случае вам не придется каждый раз писать заявление на получение ЕГРО в электронном виде.

Для получения годовой подписки необходимо подтвердить факт оплаты, предоставив оригинал платежного документа, и написать запрос по установленной форме. Эти документы необходимо подать в налоговую службу Федерации лично или по почте. При этом обращаем ваше внимание на то, что на электронных носителях такая информация не предоставляется физическим, юридическим лицам или предпринимателям.

Оформление доступа к базе данных

После получения соответствующего заявления и подтверждения факта уплаты сотрудники налоговой службы принимают решение о возможности использования реестра. Для этого заявителю выдается имя, пароль и другие данные, которые позволят его идентифицировать. Эту информацию можно получить из уведомления, которое обязательно отправляется получателю. Предоставленные атрибуты доступа имеют срок действия 1 год и 6 месяцев. В этом случае последний из них предоставляется для первого входа в систему.Это возможно только на 6 месяцев с момента принятия решения об открытии доступа. По истечении установленного срока использования реестра информация из него перестает быть доступной. Для получения нового доступа необходимо оформить такой же пакет документов.

Информация для госорганов

Для обеспечения деятельности многих госорганов необходима информация о субъектах хозяйствования, которую они могут получить только в налоговой инспекции. Для них выписка из реестра предоставляется бесплатно.В этом случае они могут как использовать данные реестра в Интернете, так и получать необходимую информацию на электронных носителях.

Федеральным органам для получения данных из налоговой необходимо обращаться в ФНС или ее межрегиональную инспекцию. Только там выдадут соответствующий доступ. Субъекты местного самоуправления или территориальные органы власти могут обратиться в ФНС по месту жительства.

Однако любой из них должен подать заявление по форме, утвержденной налоговой службой.Следует отметить, что для ЦБ, всех органов государственной власти и местного самоуправления срок действия доступа не установлен, он неограничен.

Электронное обслуживание информации ЕГРИП. Выписка из реестра

Оплаченные заказы отправляются покупателям на электронную почту в ручном режиме в рабочее время с 9 до 19 по Москве в рабочие дни.

Курьерская доставка по МКАД 300 руб!

Для МКАД стоимость 500 руб.

Доставка заверенная синей печатью ведомости по Москве осуществляется в день оформления заказа при заказе до 10.00, после следующего. рабочий день. В Подмосковье доставляем 1-2 дня в радиусе 30 км от МКАД

.

Заказать выписку из реестра с ЭЦП онлайн

Процесс оформления разделен на 2 этапа:

  1. В форме справа необходимо указать ИНН организации, после добавления в корзину необходимого количества выписок нажмите на кнопку «Заказы».

  2. На втором этапе Вам необходимо заполнить свои контактные данные и оплатить заказ. банковская карта или счет на имя организации.
    После оплаты заказа мы отправляем запрос в налоговую и обычно в течение 10 минут отправляем выписку на вашу электронную почту к выписке из инкорпорации в формате PDF, заверенную усиленной квалифицированной электронной подписью IFS.
  3. Стоимость выписки из реестра с ЭЦП — 199 рублей

    Квитанция приравнивается к бумажной выписке из реестра

    Настоящая выписка в соответствии с положениями пунктов 1, 3 статьи 6 Федерального закона от 6 апреля 2011 г.63-ФЗ «Об электронной подписи» юридически приравнивается к бумажному документу, который заверяется синей печатью налоговой.

    Нет смысла распечатывать выписку с ЭЦП, так как она имеет силу только в том оригинальном виде, в котором мы ее вам отправили, электронная почта должна быть передана на флешке или по электронной почте.

    Подходит для:

  • Нотариус при проверке юридических лиц.
  • Электронные площадки — Пройти аккредитацию на электронной торговой площадке.
Образцы подписей ЭЦП на выписках из реестра

Часто задаваемые вопросы

Срок действия действующих нормативных актов ограничен. Однако на практике у большинства банков, нотариусов, конкурсных комиссий и других организаций, где необходимо подать выписку из единого реестра юридических лиц, могут быть установлены индивидуальные требования к выдаче выписки из реестра (обычно это не более 10 или 30 дней)

1.Вы можете у нас на сайте

2. Если вас интересует обычный способ с двумя поездками в налоговую, то вам необходимо обратиться в налоговую инспекцию (ИФНС) по месту учета организации или управления (УФНС), составив заявление установленной формы с приложением квитанции об уплате госпошлины в размере 200 или 400 рублей.

Образец заявления о квитанции, а также реквизиты квитанции об уплате госпошлины можно получить в самой налоговой инспекции.

Все владельцы бизнеса, являющиеся юридическими лицами, а также их сотрудники (руководители предприятий, экономисты, финансисты и бухгалтер) периодически сталкиваются с необходимостью обращения с просьбой о выписке из реестра. Что это за документ? Где и как скоро вы его получите?

Что такое выписка из реестра и зачем она нужна

Выписки из одного государственного реестра Юридические лица — это официальные документы, подтверждающие факт существования организации, а также ее право на осуществление той или иной деятельности.

Данная выписка содержит детальную информацию о юридическом лице .

Регистрацией и предоставлением выписок из нее вправе заниматься ФНС (Федеральная налоговая служба) Российской Федерации. Этот документ может понадобиться при совершении любых юридических или финансовых операций:

  1. Для официального подтверждения фактического существования предприятия.
  2. При открытии или закрытии расчетного банковского счета.
  3. В процессе нотариального заверения и судебного разбирательства.
  4. При заключении сделок по покупке, продаже, аренде имущества компании (в том числе недвижимого).
  5. Для оформления кредита и привлечения инвесторов.
  6. Для участия в тендерах, аукционах и торгах.
  7. При расширении сферы деятельности, ликвидации, реорганизации предприятия и регистрации процедуры банкротства.

Запросить выписку из реестра можно не только в свою компанию, но и в любое другое.В бизнесе — надежное партнерство, в бизнесе — народная мудрость гласит: «Доверяй, но проверяй!».

В зависимости от носителя выписки из реестра делятся на два основных типа:

Официальная выписка из государственного реестра по своему содержанию может быть:

  1. Нормальный . Не содержащий конфиденциальной и коммерческой информации (паспортные данные учредителей компании, ведущие банковские счета и т. Д.). В большинстве случаев такой документ запрашивают третьи лица, которые хотят привести справки о предприятии.
  2. Расширенный . Такие заявления предоставляют только сами налогоплательщики, их доверенные лица, правоохранительные, судебные и другие государственные органы. Они содержат исчерпывающую информацию о предприятии и его учредителях.

Также выписка может быть платная или бесплатная , срочная или независимая . В обычном порядке выписка из государственного реестра выдается на пятый рабочий день после официального запроса.В срочном порядке его можно получить в течение дня или даже нескольких часов.

Услуги по предоставлению информации

Порядок предоставления данных из ЕГРЮЛ регулируется Приказом Минфина РФ от 15 января 2015 г. № 5н На сегодняшний день существует несколько возможностей получения выписки из государственного реестра :

  1. Обратившись в налоговую инспекцию.
  2. С помощью сторонних уполномоченных организаций.
  3. Через Интернет.

На сайте ФНС РФ есть удобные и полезные электронные сервисы, позволяющие получить необходимую информацию в кратчайшие сроки, среди них:

Бумажные носители с каждым годом теряют свою актуальность. С 1 января 2017 г. свидетельства о регистрации новых фирм и компаний не выдаются, их заменяют выписки (ведомости) из Госреестра. Новая форма этих документов утверждена приказом Налоговой службы №ММБ 7-14 / 481, на нем нет полей для штамповки пломб.

Пошаговая инструкция в 2019 году

Выбрав один из вариантов получения выписки, следует определиться с , для каких целей он нужен и насколько срочно . Каждый из возможных способов имеет определенные преимущества и недостатки, поэтому стоит рассмотреть их более подробно.

Через отделение ИФНС

Несмотря на то, что стагнация печати этого документа потеряла свою актуальность, многие чиновники в силу своего консерватизма потребуют официальный документ на бумаге.Его получение состоит из нескольких этапов :

  1. Составление и подача заявки на получение информации. Он может быть составлен в произвольной форме или по одному из образцов: на себя или другое юридическое лицо.
  2. Оплата госпошлины. За предоставление безэтапной выписки — 200 руб., Срочной — 400 руб.
  3. Приложение в назначенный день для готового документа.

В случае, когда помимо выписки требуется копия любого документа о компании, запрос необходимо направить в налоговый орган по фактическому местонахождению .Если нужна только выписка, вы можете обратиться в любую близкую налоговую инспекцию, а также передать запрос через многофункциональный центр (МФЦ) или отправить по почте.

Через коммерческие организации

Если вам необходимо получить информацию о нескольких компаниях или временный доступ к реестру, то стоит обратиться в помощь уполномоченных организаций .

Их услуги будут стоить несколько дороже, но избавят от необходимости стоять в очередях и куда-то идти.

Очень важно найти работающую и надежную организацию, в которой можно было бы отправить запрос любым удобным способом: доставить бумажную заявку лично, через курьера или по почте, в электронном месте онлайн. После этого остается оплатить услуги Посредника и получить результат, опять же максимально комфортный в данном случае.

Через официальный сайт IFNS — онлайн-выписка

Для этой процедуры вам понадобится (электронная / цифровая подпись) заявителя, что позволяет назначать любые документы.Весь процесс состоит из нескольких несложных шагов:

  1. Заходим на портал ФНС, выбираем нужный регион и подраздел «Юридические лица».
  2. В желаемом сервисе заполните все запрашиваемые данные.
  3. Прочтите и согласитесь со всеми условиями.

Ответ может быть доставлен любым удобным для заявителя. Полученный в электронном виде документ будет заверен ЭЦП налоговой инспекции и будет иметь юридическую силу, равную бумажному аналогу.

FAQ

Итак, процедура получения выписки из акционерного общества достаточно проста и разнообразна, всегда можно выбрать оптимальный вариант из всех возможных.

Тем не менее вопросы по этой теме возникают часто, т.к. действующее законодательство периодически подвергается некоторым изменениям и дополнениям. Рассмотрим самые актуальные и распространенные.

  • Что делать, если я не знаю ОГРН / ОГНП? Вы ​​можете получить электронную выписку в виде распечаток на сайте ФНС как на ВЛ, так и на ИП.И бесплатно, за считанные минуты, по Inn или по точному названию организации. В полученной выписке эти данные будут указаны, а также на свидетельстве о постановке на учет в ФНС.
  • Какую информацию я могу узнать с помощью электронной выписки из реестра? Вся общедоступная информация: не прекратила свое существование, когда была основана и каким изменениям подлежала информация об ее учредителях, местонахождении и деятельности, данные о филиалах общества, акционерах, кредиторах и инвесторах, процент долей в уставном капитале.
  • Является ли электронная выписка из регистрации юридически значимой? Только если он сертифицирован ЭЦП. Полученная справка и распечатанная выписка не будут иметь юридической силы и быть официальным документом.
  • Можно ли получить выписку бесплатно? На бесплатное предоставление служебной выписки можно рассчитывать на государственные органы, органы власти и внебюджетные фонды, суды, правоохранительные органы и т. Д. Вы можете получить электронную выписку бесплатно, но для того, чтобы она имела юридическую силу, необходима ЭЦП.Возможно получение информационной выписки в электронном виде в виде распечатки. Для этого разместите запрос на сайте FNS и получите ответ по электронной почте в виде ссылки, которая будет доступна в течение пяти дней. Однако следует учитывать, что этот вариант не будет официальным документом.

Срок приема и срок действия

Согласно Регламенту, в обычном порядке можно получить официальный документ в течение пяти рабочих дней. В срочном порядке — в течение дня.Сроки заявления установлены на законодательном уровне для трех конкретных случаев :

  1. Участие в публичных торгах — до 6 месяцев.
  2. Отчуждение доли капитала — от десяти до тридцати дней.
  3. Судебное разбирательство — в течение месяца.

В других ситуациях срок действия документа определяется органом, выдавшим его, и зависит от цели.

Какую информацию содержит выписка

Обычный вариант содержит только общедоступную информацию, без паспортных данных, расчетных счетов и т. Д.Расширенный список записей о регистрации включает дополнительную информацию:

  1. Полный.
  2. Форма организации (ОАО, ЗАО, ООО).
  3. Сведения о размере уставного капитала и всех учредителях организации.
  4. Адреса учреждений: фактические и юридические.
  5. Информация обо всех изменениях, которым подвергалось предприятие за все время существования.
  6. Информация о наличии филиалов и лицензии на осуществляемую деятельность.
  7. ОГРН, КПП, ОКЕВД.
  8. Дата создания организации и постановки налогового учета.

Можно ли заказать с доставкой в ​​офис?

Определенно да. Для многих деловых людей личные сбережения являются главным приоритетом. В этом случае возможны два варианта :

  1. Воспользуйтесь услугами коммерческой организации и курьерской службы, но решать придется существенно.
  2. При оформлении запроса на сайте ИФНС указать, что документ требуется на бумажном носителе.Выписка будет доставлена ​​по почте, но, к сожалению, не так быстро, как в первом случае.

Еще один важный момент: органы, оказывающие муниципальные и госуслуги, взаимодействуют с ИФНС в рамках единой межведомственной системы и не вправе требовать выписку из ЕГРЮЛ от обратившегося к ним заявителя (ФЗ № 102 от 20.04.2015).

В условиях финансового кризиса российские бизнесмены демонстрируют удивительные способности и в кратчайшие сроки решают самые сложные задачи.Получить выписку из акционерного общества сейчас точно не составит для них труда.

Как получить выписку из реестра противника в электронном виде? Узнайте в этом видео.

Справка из единого государственного реестра — это документ, содержащий всю информацию о зарегистрированной организации. Он нужен для нотариального заверения документов юридического лица, для банковских операций, участия в тендерах или суде, для заключения сделок. Такие выписки налоговая инспекция выдает с личным доступом в отдел.Более быстрый и простой информационный документ можно получить в. Ниже описано, как сделать отрывок за несколько минут.

Оформление выписки через Интернет

На официальном сайте ФНС Налог.ру размещена информация и сервисы для удобного общения с налоговой. Здесь это возможно обычным гражданам, индивидуальному предпринимателю, юридическому лицу. После регистрации пользователь видит свои налоговые сборы, долги перед бюджетом, может оплачивать свои счета онлайн. Также через офис вы можете переписаться с налоговой инспекцией, получить консультацию, задать интересующие вопросы.

Особенно удобный портал для ИП и Юрлиц. Учетные записи данных категорий налогоплательщиков предназначены для быстрого и удобного взаимодействия с ФНС. Одна из самых популярных возможностей сайта — это регистрация выписки из ЕГРИП и ЕГРЮЛ. Юридическим лицам такой документ может понадобиться в любой момент, без него собственнику организации сложно доказать свои права на имущество.

Выполнение происходит:

  • официальный — это тот, который выдает только налоги.Документ в виде прошитых пронумерованных листов, заверенный гербовой печатью;
  • электронный — это тот, который можно получить удаленно. Он содержит общую информацию о предприятии, доступную каждому. Это подтверждается электронной подписью налога, имеющего ту же юридическую силу, что и бумажный аналог.

В Tax LC вы можете получить только электронную версию. Также его можно распечатать на бумажном носителе. Такой документ интересен тем компаниям, которые хотят проверить информацию о контрагентах или потенциальных компаньонах для устранения рисков.

Выписка оформляется как:

  1. Заходим на сайт ФНС.
  2. Если на портале уже есть личный кабинет, просто. Если учетной записи еще нет, мы ее создаем. Сразу стоит отметить, что такая учетная запись позволяет получать выписки только из единого реестра. Чтобы использовать все возможности сайта, вам необходимо.
  3. На главной странице находим раздел «Все услуги», переходим в него.
  1. Откроется список всех электронных сервисов ФНС.Среди них есть нужный раздел.

  1. Щелкните ссылку. Если учетной записи нет, появится блок ввода. Под ним ссылка для регистрации. Нажмите здесь.

  1. На карте рецепции заполните все поля, трактир и отчество вписать необязательно.

  1. Нажмите кнопку «Продолжить». Ссылка для активации придет на указанную почту, пройдите по ней. Он автоматически переводится на страницу запроса, нажмите «Отправить новый».Получить выписку из инкорпорации через личный кабинет еще проще, страница запроса появится сразу после перехода по всем сервисам.

  1. Далее в соответствующее поле вводим ИНН юридического лица или ОГРН. Нажмите «сформировать заявку».

После этого остается только дождаться, когда документ сформируется. Процесс обычно занимает 2-5 минут, для проверки лучше периодически обновлять страницу.Если справка не появилась в течение дня, необходимо повторно заказать выписку из реестра. Когда документ будет готов, в отчете появится ссылка на него.

Документ оформлен в виде файла PDF. Для просмотра или переноса на электронный носитель достаточно перейти по ссылке. Также этот документ можно распечатать, если требуется бумажная выписка. Будет полная общая информация о предприятии, его филиалах, владельце. В документе нет данных, которые могут использовать злоумышленники.

На последней странице файла стоит отметка о том, что документ удостоверяется подкреплением квалифицированной подписью ФНС. По описанному алгоритму вы можете получить информацию о личной организации или о предприятии конкурентов / товарищей / поставщиков.

Выписка из реестра из личного кабинета Не отличается от бумажной версии и имеет такое же юридическое значение. При личном обращении в ИФНС за такую ​​справку необходимо заплатить 200-400 рублей в зависимости от срочности.Через Интернет это намного проще и быстрее, к тому же не нужно платить комиссию за получение электронной выписки. Теперь вы знаете, как это делать.

Выписка из реестра с ЭЦП налоговой можно получить любым лицом. Документ передается заявителю в электронном виде и заверяется налоговой инспекцией. В статье представлена ​​подробная инструкция, использование которой позволяет быстро и просто получить выписку.

Что регулируется возможностью получения выписки из реестра с ЭЦП налоговой службы?

Законодательство также улучшается с развитием электронных технологий.В настоящее время есть официальная возможность запросить заверенные копии документов из госреестров через Интернет. В силу п.1 ст. 7 ФЗ «О государственной регистрации юридических лиц I. индивидуальных предпринимателей» от 08.08.2001 № 129 Информация из Учреждения в электронном виде предоставляется бесплатно. Информация передается по электронной форме Б. и закрепляется за усиленной квалифицированной ЭЦП налога.

Для получения выписки из реестра заявителю не нужно оформлять ЭЦП в удостоверяющем центре.

Доступ к выписке предоставляется на следующий день после поступления заявки в ФНС, а ссылка для скачивания (в формате PDF) доступна в течение 5 дней. Напоминаем, что усиленная квалифицированная ЭЦП эквивалентна бумажному документу с «живой» подписью и печатью.

Проблема только одна. Если сам заявитель не имеет сертификата ЭЦП, он не сможет проверить подлинность ЭЦП налоговой, которая заверяется. Дело в том, что для аутентификации требуется специальное программное обеспечение — криптопродер и специальный плагин.Их выдают удостоверяющие центры. Подробная инструкция по настройке данной программы Ведется по ссылке: https://service.nalog.ru/vyp/sign-help.html.

Как получить выписку из налога на ЭЦП?

Для получения документа требуется всего несколько простых действий, порядок которых мы для удобства разместили в хронологическом порядке:

  1. Перейти на страницу регистрации на сайте Федеральной налоговой службы По адресу в Интернете: service .nalog.ru/vyp/. В правой части экрана под полями логина и пароля нажмите кнопку «Регистрация».
  2. Введите необходимые данные: e-mail, пароль, ФИО, цифры с картинки (антиспам), нажмите кнопку «Продолжить».
  3. Получите ссылку на электронную почту с активацией учетной записи и пройдите по ней.
  4. Введите логин и пароль на сайте ФНС, войдите в созданный аккаунт.
  5. Подать заявку на получение выписки из реестра на странице: service.nalog.ru/vyp/, заполнив необходимые данные: ОГРН, ИНН или орган, данные в поле антиспама (цифровой код).
  6. Подождите, когда заявка будет обработана. После обработки появится ссылка, по которой вы сможете скачать выписку из реестра с ЭЦП налога.

Таким образом, процесс получения выписки из реестра с ЭЦП по налогу довольно прост. Необходимо зарегистрироваться по указанной выше ссылке и ввести данные организации, которые требуются, от которых требуется.

Какие сведения содержатся в выписке из реестра

Сведения о регистрации компаний в соответствии с п. 8 ст.6 Закона «О государственной регистрации юридических лиц и индивидуальных предпринимателей» от 08.08.2001 № 129-ФЗ размещен на официальном сайте государственного заказа, который прошел регистрацию. Согласно ст. 2-й акт государственной регистрации осуществляется уполномоченным исполнительным органом — ФНС в соответствии с п. 2 шт. 1 позиция, утв. Постановление Правительства Российской Федерации от 30 сентября 2004 г. № 506.

Состав и полнота информации о юридических лицах, предоставляемой в регистрирующих органах в сети Интернет, определены приказом Минфина от 05.12.2013 № 115н. Это согласно п.1 приложения к приказу № 115н:

.
  • полное и сокращенное наименование;
  • адрес юридических лиц в пределах его местонахождения;
  • Адрес электронной почты
  • ;
  • ОГРН и дату внесения информации в реестр;
  • способ образования юридического лица и состав учредителей;
  • другая информация способствовала возбуждению в процессе управления юридическим лицом.

Информация о государственной регистрации Юрлица доступна в Интернете для справки ежедневно (п. 3 Приложения к Приказу №115н). Они могут даже не зарегистрироваться на сайте FNS. Однако, если вам нужна выписка, имеющая силу бумажного оригинала, тогда вам необходимо получить электронный документ с усиленным органом регистрации цифровой подписи.

Такой документ часто нужен для участия в аукционе. При этом государственные органы или службы, оказывающие муниципальные услуги, не должны требовать выписку из ЕГРЮЛ, так как при необходимости они могут запросить ее самостоятельно и получить систему межведомственного взаимодействия.

Какой силой имеет выписка из Налоговой ЭЦП

Согласно п. 1 ст. 7 Закона № 129-ФЗ Существует возможность бесплатно получить информацию о Юрлице. Заинтересованное лицо получает информацию в виде выписки из государственного реестра или справки об отсутствии информации, которые представляются в виде электронного документа (в формате PDF), подписанного КЭП (с его визуализацией) налоговой. .

ВНИМАНИЕ! Если вы откроете электронный документ с помощью Adobe Reader без применения настроек, предназначенных для тестирования EDS, появится сообщение о том, что подпись недействительна.Проверка достоверности ЭЦП производится по ГОСТ Р 34.10-2001 .

Не знаете свои права?

Электронный документ — выписка из инкорпорации с Налоговой ЭЦП — по пп. 1, 3 ст. 6 Закона «Об электронной подписи» от 06.04.2011 № 63-ФЗ имеет полную юридическую силу и приравнивается к оригиналу в бумажной форме, подписанному должностным лицом Уполномоченного и заверенной печатью. Электронную выписку можно распечатать, переслать по почте, скопировать на флешку, сохранив целостность файла.

Для получения выписки из электронной подписи налогоплательщика заявителю не требуется наличие сертификата ключа ЭЦП. Предоставление заказанной информации не позднее следующего дня после запроса. На практике от заказа до получения проходит не более 10 минут. Скачать с сайта IFTS выписку из эраида с электронной подписью можно будет в течение 5 дней.

Как попасть в ИФНС выписку из реестра

Выписку с налогом на ЭЦП предоставляет уполномоченный заявитель.Для того, чтобы воспользоваться услугой и получить информацию (выписку или справку об отсутствии информации) из реестра с ЭЦП налога, необходимо зарегистрироваться на портале ФНС по ссылке.

После активации вашего логина (это будет адрес, указанный при регистрации электронной почты) Впоследствии вы легко сможете перейти на сервис.

Выберите «Юридическое лицо», введите ИНН или ОГРН компании, затем заполните поле изображения. В ответ вы получите файл в формате PDF — это будет запрошенная выписка с усиленной налоговой подписью.

В отличие от бумажной выписки из учреждения, которая оформляется на платной основе сроком от 1 до 5 дней, электронный аналог документа можно получить практически мгновенно и совершенно бесплатно. Выписку может заказать любое лицо, прошедшее регистрацию на сайте ФНС в разделе о получении таких документов. Электронная выписка с усиленной цифровой налоговой подписью имеет силу аналогичного документа, выполненного традиционным способом на бумажном носителе и заверенного постановлением Правительства.

Главная »Открытие» Электронное обслуживание информации ЕГРИП. Выписка из реестра — как заказать. Получите выписку бесплатно с налогом на цифровую подпись

ячеек | Бесплатный полнотекстовый | Экстракт Schisandrae chinensis Fructus улучшает мышечную атрофию у мышей с диабетом, вызванным стрептозотоцином, за счет подавления CREB-KLF15 и аутофагии-лизосомных путей

Рисунок 1. Введение SFe не влияло на массу тела и уровни глюкозы в крови у мышей с STZ-индуцированным диабетом. Самцам мышей C57BL / 6 в возрасте восьми недель вводили 150 мг / кг STZ, а мышам с диабетом (уровень глюкозы в крови> 300 мг / дл) перорально вводили SFe (250 или 500 мг / кг один раз в день) в течение 6 месяцев. недели. ( A ) Массу тела и ( B ) уровни глюкозы в крови без голодания контролировали еженедельно. ( C ) Среднее потребление пищи и ( D ) потребление воды в течение 6 недель введения SFe.Данные представлены как среднее значение ± стандартная ошибка (SE), n = 11 на группу. *** p <0,001 по сравнению с CON_Vehicle. Односторонний дисперсионный анализ был выполнен для теста множественного сравнения Даннета.

Рисунок 1. Введение SFe не влияло на массу тела и уровни глюкозы в крови у мышей с STZ-индуцированным диабетом. Самцам мышей C57BL / 6 в возрасте восьми недель вводили 150 мг / кг STZ, а мышам с диабетом (уровень глюкозы в крови> 300 мг / дл) перорально вводили SFe (250 или 500 мг / кг один раз в день) в течение 6 месяцев. недели.( A ) Массу тела и ( B ) уровни глюкозы в крови без голодания контролировали еженедельно. ( C ) Среднее потребление пищи и ( D ) потребление воды в течение 6 недель введения SFe. Данные представлены как среднее значение ± стандартная ошибка (SE), n = 11 на группу. *** p <0,001 по сравнению с CON_Vehicle. Односторонний дисперсионный анализ был выполнен для теста множественного сравнения Даннета.

Рисунок 2. Введение SFe увеличивало силу захвата и мышечную массу GA у мышей с STZ-индуцированным диабетом.( A ) Сила захвата измерялась после 40 дней введения SFe. ( B ) Вес TA, GA и QD измеряли сразу после умерщвления мышей и нормализовали по массе тела каждой мыши. Данные представлены в виде среднего значения ± стандартная ошибка, n = от 6 до 7 на группу. * p <0,05, ** p <0,01 или *** p <0,001. Односторонний дисперсионный анализ был выполнен для теста множественного сравнения Даннета.

Рисунок 2. Введение SFe увеличивало силу захвата и мышечную массу GA у мышей с STZ-индуцированным диабетом.( A ) Сила захвата измерялась после 40 дней введения SFe. ( B ) Вес TA, GA и QD измеряли сразу после умерщвления мышей и нормализовали по массе тела каждой мыши. Данные представлены в виде среднего значения ± стандартная ошибка, n = от 6 до 7 на группу. * p <0,05, ** p <0,01 или *** p <0,001. Односторонний дисперсионный анализ был выполнен для теста множественного сравнения Даннета.

Рисунок 3. Введение SFe увеличивало размер мышечных волокон у мышей с STZ-индуцированным диабетом.( A ) Окрашивание H&E срезов мышц GA, TA и QD. Показаны репрезентативные изображения (× 200) (GA: n = 5 на группу, TA и QD: n = 4 на группу). ( B , C ) Распределение площади поперечного сечения (CSA) мышечных волокон измеряли с помощью программы ImageJ; показаны средние CSA ( B ) и процентное содержание волокон ( C ) (GA: n = 5 на группу, TA и QD: n = 4 на группу). ( D ) Многоцветное флуоресцентное окрашивание мышечного среза GA.Показаны репрезентативные изображения (× 100) (n = 4 на группу). Фиолетовый: волокно типа I, зеленый: волокно типа IIa, красный: волокно типа IIb. ( E ) Средние значения CSA волокон типа I, IIa и IIb в мышце GA измеряли с помощью программы ImageJ. Данные представлены как среднее ± стандартная ошибка. * p <0,05, ** p <0,01, *** p <0,001. Односторонний дисперсионный анализ был выполнен для теста множественного сравнения Даннета.

Рисунок 3. Введение SFe увеличивало размер мышечных волокон у мышей с STZ-индуцированным диабетом.( A ) Окрашивание H&E срезов мышц GA, TA и QD. Показаны репрезентативные изображения (× 200) (GA: n = 5 на группу, TA и QD: n = 4 на группу). ( B , C ) Распределение площади поперечного сечения (CSA) мышечных волокон измеряли с помощью программы ImageJ; показаны средние CSA ( B ) и процентное содержание волокон ( C ) (GA: n = 5 на группу, TA и QD: n = 4 на группу). ( D ) Многоцветное флуоресцентное окрашивание мышечного среза GA.Показаны репрезентативные изображения (× 100) (n = 4 на группу). Фиолетовый: волокно типа I, зеленый: волокно типа IIa, красный: волокно типа IIb. ( E ) Средние значения CSA волокон типа I, IIa и IIb в мышце GA измеряли с помощью программы ImageJ. Данные представлены как среднее ± стандартная ошибка. * p <0,05, ** p <0,01, *** p <0,001. Односторонний дисперсионный анализ был выполнен для теста множественного сравнения Даннета.

Рисунок 4. Введение SFe снижало экспрессию MuRF1, атрогина-1 и убиквитин-меченого белка у мышей с STZ-индуцированным диабетом.( A ) Уровни мРНК генов, кодирующих MuRF1 и атрогин-1, анализировали с помощью RT-qPCR в мышечной ткани GA. МРНК GAPDH служила внутренним контролем (n = 4 на группу). ( B ) Экспрессию белков фосфо-FOXO1, FOXO1, MuRF1, атрогина-1 и MSTN в мышцах GA анализировали с помощью вестерн-блоттинга с экспрессией GAPDH в качестве внутреннего контроля. Количественное определение p-FOXO1 / FOXO1, MuRF1, атрогина-1 и MSTN рассчитывали с использованием программного обеспечения ImageJ. Количественные значения выражены как относительное кратное изменение по сравнению с группой CON_Vehicle.Данные представлены в виде среднего значения ± стандартное отклонение (SD) (n = 5 на группу). * p <0,05, ** p <0,01 или *** p <0,001. Односторонний дисперсионный анализ был выполнен для теста множественного сравнения Даннета. ( C ) Экспрессию белка, меченного убиквитином, в мышцах GA анализировали с помощью вестерн-блоттинга с окрашиванием Ponceau S в качестве внутреннего контроля.

Рисунок 4. Введение SFe снижало экспрессию MuRF1, атрогина-1 и убиквитин-меченого белка у мышей с STZ-индуцированным диабетом.( A ) Уровни мРНК генов, кодирующих MuRF1 и атрогин-1, анализировали с помощью RT-qPCR в мышечной ткани GA. МРНК GAPDH служила внутренним контролем (n = 4 на группу). ( B ) Экспрессию белков фосфо-FOXO1, FOXO1, MuRF1, атрогина-1 и MSTN в мышцах GA анализировали с помощью вестерн-блоттинга с экспрессией GAPDH в качестве внутреннего контроля. Количественное определение p-FOXO1 / FOXO1, MuRF1, атрогина-1 и MSTN рассчитывали с использованием программного обеспечения ImageJ. Количественные значения выражены как относительное кратное изменение по сравнению с группой CON_Vehicle.Данные представлены в виде среднего значения ± стандартное отклонение (SD) (n = 5 на группу). * p <0,05, ** p <0,01 или *** p <0,001. Односторонний дисперсионный анализ был выполнен для теста множественного сравнения Даннета. ( C ) Экспрессию белка, меченного убиквитином, в мышцах GA анализировали с помощью вестерн-блоттинга с окрашиванием Ponceau S в качестве внутреннего контроля.

Рисунок 5. Введение SFe не влияло на экспрессию молекул, связанных с синтезом белка. Экспрессию белков Phospho-Akt, Akt, phospho-p70S6K1 и p70S6K1 в мышцах GA анализировали с помощью вестерн-блоттинга; Экспрессия GAPDH была внутренним контролем.Экспрессию генов количественно оценивали с помощью программного обеспечения ImageJ. Данные представлены в виде среднего значения ± стандартное отклонение (SD) (n = 5 на группу).

Рисунок 5. Введение SFe не влияло на экспрессию молекул, связанных с синтезом белка. Экспрессию белков Phospho-Akt, Akt, phospho-p70S6K1 и p70S6K1 в мышцах GA анализировали с помощью вестерн-блоттинга; Экспрессия GAPDH была внутренним контролем. Экспрессию генов количественно оценивали с помощью программного обеспечения ImageJ. Данные представлены в виде среднего значения ± стандартное отклонение (SD) (n = 5 на группу).

Рисунок 6. Введение SFe снижало экспрессию p-CREB / CREB и KLF15 у мышей с индуцированным STZ диабетом. Экспрессию белков фосфо-CREB (p-CREB), CREB и KLF15 в мышцах GA анализировали с помощью вестерн-блоттинга с экспрессией GAPDH в качестве внутреннего контроля. Количественное определение p-CREB / CREB и KLF15 проводили с использованием программного обеспечения ImageJ. Количественные значения выражены как относительное кратное изменение по сравнению с группой CON_Vehicle. Данные представлены в виде среднего значения ± стандартное отклонение (SD) (n = 5 на группу).* p <0,05 или ** p <0,01. Односторонний дисперсионный анализ был выполнен для теста множественного сравнения Даннета.

Рисунок 6. Введение SFe снижало экспрессию p-CREB / CREB и KLF15 у мышей с индуцированным STZ диабетом. Экспрессию белков фосфо-CREB (p-CREB), CREB и KLF15 в мышцах GA анализировали с помощью вестерн-блоттинга с экспрессией GAPDH в качестве внутреннего контроля. Количественное определение p-CREB / CREB и KLF15 проводили с использованием программного обеспечения ImageJ. Количественные значения выражены как относительное кратное изменение по сравнению с группой CON_Vehicle.Данные представлены в виде среднего значения ± стандартное отклонение (SD) (n = 5 на группу). * p <0,05 или ** p <0,01. Односторонний дисперсионный анализ был выполнен для теста множественного сравнения Даннета.

Рисунок 7. SFe снижает экспрессию лизосомальных маркеров аутофагии у мышей с STZ-индуцированным диабетом. ( A ) Экспрессию белков p62 / SQSTM1, Atg7, LC3-I, LC3-II, Beclin-1, p-ULK-1 и ULK-1 в мышцах GA анализировали с помощью вестерн-блоттинга; Экспрессия GAPDH была внутренним контролем. ( B ) Количественное определение белков p62 / SQSTM1, Atg7, LC3-I, LC3-II, Beclin-1 и p-ULK-1 / ULK-1 вычисляли с использованием программного обеспечения ImageJ.Количественные значения выражены как относительное кратное изменение по сравнению с группой CON_Vehicle. Данные представлены как среднее ± стандартное отклонение (n = 5 на группу). * p <0,05, ** p <0,01 или *** p <0,001. Односторонний дисперсионный анализ был выполнен для теста множественного сравнения Даннета.

Рисунок 7. SFe снижает экспрессию лизосомальных маркеров аутофагии у мышей с STZ-индуцированным диабетом. ( A ) Экспрессию белков p62 / SQSTM1, Atg7, LC3-I, LC3-II, Beclin-1, p-ULK-1 и ULK-1 в мышцах GA анализировали с помощью вестерн-блоттинга; Экспрессия GAPDH была внутренним контролем.( B ) Количественное определение белков p62 / SQSTM1, Atg7, LC3-I, LC3-II, Beclin-1 и p-ULK-1 / ULK-1 вычисляли с использованием программного обеспечения ImageJ. Количественные значения выражены как относительное кратное изменение по сравнению с группой CON_Vehicle. Данные представлены как среднее ± стандартное отклонение (n = 5 на группу). * p <0,05, ** p <0,01 или *** p <0,001. Односторонний дисперсионный анализ был выполнен для теста множественного сравнения Даннета.

Таблица 1. Наборы праймеров, используемые для количественного анализа ПЦР.

Таблица 1. Наборы праймеров, используемые для количественного анализа ПЦР.

No. Праймер Чувство Антисмысловые +
1 MuRF1 AGGACTCCTGCAGAGTGACCAA TTCTCGTCCAGGATGGCGTA
2 Atrogin-1 GCAAACACTGCCACATTCTCTC CTTGAGGGGAAAGTGAGACG
3 18s рРНК CCATCCAATCGGTAGTAGCG GTAACCCGTTGAACCCCATT

Однодозовая CRISPR / Cas9-терапия продлевает продолжительность жизни мышей с синдромом Хатчинсона-Гилфорда 2 с абстрактным синдромом Хатчджинсона 9000 Прогилсона-Гилфорда летальное генетическое заболевание, характеризующееся симптомами, напоминающими ускоренное старение.Основная генетическая причина — это мутация замещения в гене, кодирующем ламин А, вызывающая выработку токсичной изоформы, называемой прогерином. Здесь мы показываем, что уменьшение ламина A / прогерина путем однократного системного введения AAV-доставленных компонентов CRISPR / Cas9 подавляет HGPS в модели мыши.

Ламинопатии — это дегенеративные заболевания, вызванные мутациями, которые влияют на белки ядерной пластинки 1 . В наиболее тяжелых формах наблюдается ускоренное старение на уровне организма в сочетании с преждевременной дегенерацией множества тканей и органов 2 .Следовательно, эти заболевания являются привлекательными платформами для выявления молекулярных игроков старения 3,4 . HGPS — одна из наиболее тяжелых форм таких заболеваний с ранним началом, быстрым прогрессированием и гарантированной летальностью 5,6 . Диагноз ставится вскоре после рождения и приводит к летальному исходу в среднем в возрасте 14,6 лет 7 . В настоящее время лекарства не существует, и текущие методы лечения направлены на облегчение сопутствующих симптомов 8 . Хотя ингибиторы фарнезилтрансферазы (ИФТ) продемонстрировали определенные улучшения и в настоящее время проходят клинические испытания, этот подход имеет ограничения из-за возможных побочных эффектов ИФТ на другие белковые субстраты CaaX , а также из-за того, что эффект накопленного нефарнезилированного прогерина неясен 9 .Большинство случаев HGPS (~ 90%) является результатом de novo c. Мутация C1824T (p.Gly608Gly), которая увеличивает использование скрытого сайта сплайсинга и производство усеченного ламина А, называемого прогерином 10–12 . Усечение удаляет сайт эндопротеолитического расщепления, предотвращая удаление фарнезилированного хвоста. Следовательно, деформируется ядерная оболочка и нарушаются связанные с ней клеточные функции, такие как стабильность генома, эпигенетическая регуляция экспрессии генов, белковый и энергетический метаболизм, а также ядерно-цитоплазматический транспорт 3,4,6,13 .Индукция соответствующей мутации у мышей (Gly609Gly) индуцирует аналогичные фенотипы, как и у людей 14 . С другой стороны, от ламина А можно отказаться, возможно, из-за компенсации его более короткой изоформы ламина С 14,15 , а мыши без ламина А живут дольше, чем мыши дикого типа 16 , что указывает на то, что HGPS не является результатом отсутствие ламина А, но из-за накопления прогерина. Таким образом, мы пришли к выводу, что HGPS можно лечить с помощью CRISPR-Cas9-целевого разрушения ламина A / прогерина.

Две направляющие РНК (гРНК: gLmna-1 и gLmna-2) для Streptococcus pyogenes Cas9 (SpCas9), нацеленные на ламин A ниже ламина C, были разработаны для уменьшения ламина A / прогерина без нарушения ламина C (). Эффективность нацеливания оценивали на фибробластах, выделенных из HGPS; Мыши Cas9, которые являются гетерозиготными или гомозиготными по мутации прогерина и гемизиготными по конститутивно активному трансгену Cas9. Лентивирусная доставка гРНК по отдельности или вместе эффективно подавляла уровни прогерина и ламина А, но не ламина С (,).GRNA без сайта-мишени в геноме (фиктивная обработка) или gRNA без Cas9 не вызывали эффекта, указывающего на то, что подавление регуляции происходит в результате нацеливания на ламин A / прогерин с помощью CRISPR / Cas9. Интересно, что высокопроизводительное секвенирование РНК показало, что либо обработка gRNA коррелировала с понижающей регуляцией последовательностей РНК ниже ламина C, что указывает на то, что обработки вызывают ламин A / прогерин-специфическую транскрипционную интерференцию или дестабилизацию РНК (,). Аналогичное одновременное исследование 17 и предыдущая попытка взлома в этой области также привели к тому же наблюдению 15 .

Целенаправленное разрушение ламина А и прогерина с помощью CRISPR / Cas9.

a , Схема нацеливания ламина A / прогерина с помощью CRISPR / Cas9. gLmna-1 нацелен выше сайта фарнезилирования, gLmna-2 распознает сайт мутации и сайт дикого типа (). SA / D: Активатор сплайсинга / Донорский сайт. b , Схема генной терапии in vivo . AAV9-mCherry-gLmna вводили мышам в возрасте от 0 до 2 дней (P0–2). Верхняя панель показывает сигнал mCherry через 4 дня после инъекции (DPI) мыши P0 (P0–4DPI) по сравнению с контролем, инъецированным PBS (нижняя панель). c , Экспрессия репортера mCherry в различных органах на 6dpp (дни после родов, P1–5DPI). Цифры в правом нижнем углу обозначают время экспозиции в секундах. Шкала шкалы 2 мм. d , Эффективность нацеливания ламин А / прогерин. Когда две гРНК действуют одновременно, область между ними удаляется, и повторно лигированные концы могут быть обнаружены с помощью ПЦР. Черные стрелки обозначают расположение праймеров. Tfrc: положительный контроль для ПЦР. Мок: гРНК без целевого сайта в геноме. и , Иммуноблоты лизатов взрослых органов от гетерозиготных мышей HGPS (Pro / +) на гомозиготном фоне Cas9 (C9 / C9), обработанных g1 & 2, по сравнению с имитационной обработкой для оценки уровней ламина A / C / прогерина. Средняя панель соответствует самому верхнему блоту при разных экспозициях. α Тубулин: контроль нагрузки (- репрезентативные повторения по крайней мере двух независимых экспериментов). f , Общая морфология мышей. Показаны братья и сестры дикого типа и гомозиготные (гомозиготные) самки в возрасте 16,4 недель (нед) рядом с 19.4-недельные гетерозиготные (гетеро) и гомозиготные братья и сестры, обработанные g1 и 2 (также показаны на видео 1 и 2). Разница в морфологии заключается в том, что контрольный образец моложе на 3 недели. г , сравнение массы тела между 9 и 17 неделями, когда мужчины изображены слева, а женщины — справа. Для каждой прямоугольной диаграммы первый и третий квартили обозначают 25 и 75 процентиль, а черная линия представляет собой медианное значение. Усы представляют верхнюю и нижнюю границы данных.Значимость определялась односторонним дисперсионным анализом с поправкой Бонферрони. Liv, TT, Hrt, Lng, Kid, Stom, Msl, Int, Sp: печень, кончик хвоста, сердце, легкие, почки, желудок, мышцы, кишечник, селезенка.

Затем мы протестировали in vivo эффективность gRNAs в HGPS; Cas9 мыши. С этой целью отдельные гРНК с репортером mCherry были упакованы в аденоассоциированный вирус с серотипом 9 (AAV9). Учитывая, что HGPS является детским системным заболеванием, мы систематически доставляли AAV9-гРНК новорожденным мышам с помощью инъекции в лицевую вену ().Две гРНК вводили совместно для максимальной эффективности (gLmna-1 + gLmna-2). Репортер mCherry был обнаружен на 4-й день после инъекции в нескольких органах, при этом наибольшая экспрессия проявлялась в печени (, и). Распределение экспрессии mCherry по органам оставалось неизменным на протяжении взрослого возраста, за исключением кишечника, который снизился до фонового уровня (,). Геномная ДНК, выделенная из органов взрослых мышей, которым инъецировали гРНК, показала самый высокий уровень редактирования в печени в корреляции с уровнями белка (, и).Следовательно, мыши выглядели более здоровыми, улучшили осанку и вес тела (,). Более того, они были более активными, что может быть связано с системными физиологическими улучшениями и подавлением кифоза (Видео 1, 2).

Мыши HGPS не могут развиваться и постепенно теряют массу тела с возрастом 14 . Мы отслеживали прогрессирование массы тела обработанных мышей по сравнению с отрицательными контролями в возрасте двух месяцев и старше. Мы заметили, что лечение уменьшило потерю веса ().Параллельно средняя выживаемость увеличилась примерно на 25% (). Средняя выживаемость мышей HGPS, HGPS / Cas9 и HGPS / Cas9 + две Lmna-gRNA (g1 и 2) составила 16,7, 20,0 и 25,3 недель соответственно. Учитывая, что HGPS является прогрессирующим дегенеративным заболеванием, мы проанализировали гистологию желудка и кожи. Эти два органа претерпевают ускоренное старение у мышей HGPS 18 , хотя у людей с HGPS не наблюдается клинических нарушений функции желудочно-кишечного тракта. Анализируемые обработанные мыши показали качественно более здоровый железистый желудок с количеством париетальных клеток, сравнимым с контролем дикого типа, в то время как мыши, подвергшиеся ложной обработке, имели заметный дефицит париетальных клеток.Лечение также подавляло истончение эпидермиса и потерю кожного жира, два состояния кожи, связанных со старением (,).

CRISPR / Cas9-индуцированное снижение ламина A / прогерина продлевает здоровье и продолжительность жизни мышей HGPS.

a , масса тела и b , выживаемость во времени. Пурпурная линия обозначает необработанных гомозиготных мышей HGPS (Progeria), проанализированных в статье A. Ocampo et al. 18 . Мыши, изображенные синей и красной линиями, представляют собой нечто среднее между трансгенными мышами HGPS и Cas9 (мыши Progeria / Cas9).Они гомозиготны по HGPS и несут по крайней мере одну копию трансгена Cas9 (гемизиготную или гомозиготную). Синяя линия обозначает нелеченных мышей. За исключением зеленых и оранжевых ромбов на синей линии в ( b ), обозначают отрицательные контроли, обработанные имитацией, и только гРНК, соответственно. Красная линия обозначает мышей, получавших g1 и 2. Размер выборки ( n ) указывает начальное количество мышей на 9 неделе в и. Показаны средние значения ± стандартное отклонение. Для кривых массы тела и выживаемости использовались множественные t-критерии и тест логарифмического ранга (Mantel Cox), соответственно.Хотя введение одного только Cas9, по-видимому, увеличивает выживаемость, это может быть результатом различного фона штамма после скрещивания с мышами Cas9. c , Гистологические анализы желудка (верхняя панель) и кожи (нижняя панель), полученные у 19-недельных обработанных g1 и 2 гомозиготных мышей по сравнению с обработанными ложно гомозиготными мышами, рядом с обработанными ложно обработанными животными дикого типа (Wt). Стрелки и звездочки обозначают эпидермис кожи и париетальные клетки желудка соответственно. Ұ: кожный жир. Цифры внизу представляют собой увеличенные изображения областей эпидермиса, отмеченных стрелками.Изображения представляют собой репрезентативные копии двух независимых экспериментов с аналогичными результатами. Шкала 100 мкм. d , Измерение толщины эпидермиса ( n = 15 срезов на группу из 3 биологически независимых образцов). Показаны среднее значение, стандартная ошибка среднего и статистическая значимость, рассчитанные с помощью теста t непарного студента. e , Проверка силы захвата. Левая и правая панели отображают силу захвата передними и задними конечностями взрослых мышей (16-18 недель), соответственно.Каждая оценка соответствует 25 показаниям, полученным от 5 животных, измеренных 5 раз. Для каждой прямоугольной диаграммы первый и третий квартили обозначают 25 и 75 процентиль, а черная линия представляет собой медианное значение. Усы представляют верхнюю и нижнюю границы данных. Значимость определялась односторонним дисперсионным анализом с поправкой Бонферрони. f , Репрезентативный график активности ходового колеса. Показаны активности гомозиготных мышей, не получавших лечения или имитирующих лечение, и гомозиготных мышей, получавших g1 и 2.Возраст всех обработанных мышей составлял 17 недель, а контрольные мыши были моложе на 4 недели. г , Количественное определение активности ходового колеса. Возраст испытуемых мышей составлял от 10 до 18 недель. Синие столбцы обозначают мышей дикого типа ( n = 5), красные и зеленые столбцы обозначают контрольных ( n = 5) и обработанных g1 и g2 ( n = 6) гомозиготных мышей HGPS, соответственно. Показаны средние значения ± стандартное отклонение и значимость согласно непарному t-критерию.

Пациенты с HGPS умирают в основном из-за сердечно-сосудистых заболеваний, подобных тем, которые наблюдаются в пожилом возрасте, поэтому мы проанализировали дугу аорты и частоту сердечных сокращений у мышей HGPS.Лечение улучшило дегенерацию гладкомышечных клеток сосудов дуги аорты по сравнению с контрольными мышами, на что указывало увеличение числа ядер в медиальном слое (). Кроме того, хотя у людей с HGPS не наблюдается снижения частоты сердечных сокращений, электрокардиографический анализ (ЭКГ) показал, что лечение ослабило развитие брадикардии, наблюдаемой у мышей HGPS (2).

Опорно-двигательный аппарат — одна из основных систем, нарушенных во время старения и HGPS, влияющих на качество жизни.Мы оценили физиологию опорно-двигательного аппарата, подвергнув мышей тесту на силу захвата. У обработанных мышей наблюдался более сильный захват передних и задних конечностей параллельно с более высокой массой тела. Учитывая, что у HGPS нет неврологического дефицита, это наблюдение указывает на то, что физиологическое снижение скелетных мышц подавляется (и). Затем мы оценили жизнеспособность мышей, измерив их произвольную активность на бегущих колесах. Обработанные мыши сохраняли свою активность на уровне, аналогичном контролю дикого типа (,).Эти результаты показывают, что нацеливание на ламин A / прогерин с помощью CRISPR / Cas9 у мышей HGPS улучшило их физиологические функции в корреляции с гистологическими улучшениями и увеличило продолжительность их жизни.

Несмотря на увеличение выживаемости, обработанные мыши не доживали до уровня мышей дикого типа. Мы наблюдали, что значительное количество обработанных мышей умерло остро, в отличие от прогрессирующего ухудшения состояния необработанных мышей (). Перед смертью у них наблюдалась резкая потеря веса и вздутие живота параллельно с затруднением дефекации ().Анализ аутопсии показал образование Megacolon / Megacaecum вместе с затвердевшими фекалиями, предполагая, что причиной летальности была неспособность отвести экскременты (). Учитывая, что трансгенные мыши, содержащие только ламин С, не имеют симптомов 14 , тогда как накопление фарнезилированного ламина А в кишечной нервной системе вызывает те же симптомы 19 , наши наблюдения предполагают, что летальность может быть связана с недостаточностью кишечной нервной системы. толстая кишка, вызванная отсутствием редактирования генов ().Необработанные или ложно леченные мыши не развивают этот фенотип, по-видимому, потому, что они умирают заранее.

В целом, наши данные показывают, что CRISPR / Cas9-опосредованное снижение ламина А / прогерина однократной внутривенной терапией продлевает здоровье и продолжительность жизни мышей HGPS. Для этого исследования мы использовали трансгенных мышей, которые экспрессируют Streptococcus pyogenes Cas9 и экзогенно доставляют гРНК в качестве доказательства концепции. Примечательно, что в сопроводительном документе Santiago-Fernández et al. демонстрирует аналогичные выводы при внутрибрюшинной доставке Staphylococcus aureus Cas9 и гРНК 17 .Таким образом, эти два независимых исследования дополняют друг друга и раскрывают потенциальное использование CRISPR / Cas9 для лечения пациентов с HGPS у человека. Хотя эта стратегия нарушает экспрессию ламина А наряду с экспрессией прогерина, исследования с нокаутом на мышах показывают, что мыши, у которых отсутствует ламин А, жизнеспособны 14–16 и даже живут дольше, чем мыши дикого типа 16 . Учитывая, что HGPS является смертельным заболеванием, продление здоровья и продолжительности жизни пациентов с помощью этого подхода предлагает привлекательный способ вмешательства.Интересно, что хотя мы наблюдали умеренный терапевтический эффект, этот результат коррелировал с редактированием генов, происходящим в основном в печени и минимально в других органах. Нацеливание на более широкий спектр, включая толстую кишку или комбинаторную терапию с FTI 9 , может дополнительно способствовать увеличению продолжительности жизни пациентов с HGPS.

Методы

Все процедуры на животных были выполнены в соответствии с руководящими принципами NIH и одобрены Комитетом по уходу за животными в Институте Солка.

Штаммы мышей

Модель мыши HGPS (Progeria), несущая мутацию прогерина G609G, была создана Карлосом Лопес-Отином из Университета Овьедо, Испания и любезно подарена Брайаном Кеннеди из Института Бака. Streptococcus pyogenes Трансгенные мыши Cas9 были получены из лаборатории Джексона (инвентарный номер: 024858). Мыши HGPS представляют собой смесь штаммов 129 / Ola и C57BL / 6, а мыши Cas9 состоят из фонов 129, C57BL / 6N, C57BL / 6J и FVB / N. Гомозиготные мыши Progeria бесплодны.Гетерозиготных мышей скрещивали с гомозиготными мышами Cas9 для получения составных мышей. Полученных трансгетерозиготных мышей разводили для получения гомозиготных мышей Progeria, несущих трансген Cas9 (гомо- или гемизиготных). Гемизиготный фон Cas9 был достаточным для снижения уровней ламина А / прогерина (). Гетерозиготных мышей Progeria на фоне Cas9 использовали для поддержания линии. Мыши Progeria относятся к линии C57BL / 6. Мыши Cas9 находятся на смешанном фоне из 129, C57BL / 6 и FVB / N. Мышей содержали с 12-часовым циклом свет / темнота с 06:00 до 18:00 в комнате с контролируемой температурой (22 ± 1 ° C) со свободным доступом к водяным клапанам и PicoLab Rodent Diet 20 (LabDiet, Каталожный №: 5053) на крышке из проволочной сетки.Мышам, потерявшим более 20% веса за неделю или мышам, вес которых упал ниже 13 граммов, давали влажный корм на полу клетки и бутылку с водой на крышке из проволочной решетки.

Конструкция гРНК

gLmna-1 была сконструирована для нацеливания на экзон 12 гена ламина А мыши и охватывает сайт фарнезилирования. gLmna-2 был разработан для нацеливания на экзон 11 в непосредственной близости от сайта мутации C> T HGPS. ГРНК без целевого сайта в геноме использовали в качестве фиктивного контроля гРНК (гРНК Mock). Последовательности гРНК перечислены в дополнительной таблице 1.

In vivo Генная терапия LMNA

Индивидуальные гРНК были упакованы в векторы аденоассоциированного вируса-9 (AAV9) с репортером mCherry в соответствии с опубликованным протоколом 20 . Экспрессия gRNA и mCherry управлялась промоторами U6 и CAG соответственно. Смесь 1: 1 AAV9-gRNA1 и AAV9-gRNA2 вводили в 40 мкл PBS через лицевую вену новорожденным мышам под анестезией, вызванной гипотермией, в течение 48 часов после рождения (P0–2). Мышей, инфицированных AAV9, которые несут mCherry вместе с gRNA без мишени в геноме (Mock) или только mCherry, использовали в качестве отрицательного контроля в дополнение к необработанным мышам (без gRNA).Аналогичным образом, мыши без трансгена Cas9, подвергшиеся обработке AAV9-gRNA1 & 2, служили контролем «без Cas9». Все отрицательные контроли действовали аналогично. Введенный титр находился в диапазоне 2 × 10 10 — 1 × 10 12 геномных копий (gc) на гРНК вируса, как определено количественной ПЦР: 2,6 × 1010 гц всего (), 2,6 × 1011 гк каждая (), 1,2 × 1011 gc каждый (), 4,8 X 1011 gc каждый (), 6,2 X 1010 gc каждый (), 6,2 X 1010 gc каждый (). Обнаружение сигнала mCherry было получено с помощью Zeiss AxioZoom.Стереомикроскоп V16. Взрослых мышей перфузировали PBS для промывания крови перед извлечением органов для визуализации.

Для анализа геномной ДНК фрагменты органов сначала расщепляли (1 мг / мл) протеиназой K в [100 мМ NaCl, 25 мМ ЭДТА, 10 мМ Трис pH 8,0, 0,5% SDS] в течение ночи при 55 ° C. Геномную ДНК гидролизатов выделяли экстракцией фенол: хлороформ: изоамиловый спирт (25: 24: 1) с последующим осаждением этанолом. ДНК расщепляли HindIII (New England Biolabs, Каталожный №: R0104) для удаления неусеченного ламина А, чтобы способствовать амплификации ПЦР ламина А, который подвергся усечению, путем одновременного разрезания gRNA1 и 2.

Для анализа уровней белка с помощью вестерн-блоттинга органы выделяли у мышей, перфузированных PBS, и гомогенизировали в буфере RIPA [50 мМ Трис-HCl pH 7,4, 150 мМ NaCl, 2 мМ EDTA, 1% NP-40, 0,1 % SDS, 0,5% дезоксихолата натрия, 1 мМ PMSF и 1 коктейль ингибиторов мини-протеазы от Roche, номер по каталогу: 11836153001). Геномную ДНК разрезали, пропуская лизат 10 раз через иглу 23G. После 30 минут инкубации на льду лизат центрифугировали при 13000 rcf при 4 ° C в течение 5 минут для удаления остатков.Концентрацию белка оценивали с помощью набора BCA Protein Assay Kit (Pierce, № по каталогу: 23225 23227). После этого к лизату добавляли 1 мМ DTT перед обработкой 5–25 мкг общего белка на 10–20% геле трис-глицина Novex WedgeWell (каталожный номер: XP1020-Box). Иммуноблоттинг проводили на мембранах из ПВДФ 0,45 мкм. Мембраны блокировали 5% обезжиренным сухим молочным порошком в TBST (трис-буферный солевой раствор с 0,1% твина 20) в течение 20 минут при комнатной температуре. Иммуноблоттинг с первичными и вторичными антителами проводили в течение 2 часов при комнатной температуре или в течение ночи при 4 ° C.Обнаружение проводили с помощью раствора субстрата SuperSignal West Pico или Femto Chemiluminescence (ThermoFisher Scientific, Каталожный №: 34087 и 34095) на авторадиографических пленках Hyblot CL (Каталожный №: E3018). Мембраны удаляли путем инкубации в буфере для стриппинга Restore Plus (ThermoFisher Scientific, № по каталогу 46428) в течение 15 минут при комнатной температуре для повторного зондирования. Вестерн-анализы повторяли не менее двух раз с разными образцами (биологические повторы). Полноразмерные изображения иммуноблотов представлены в исходных данных, а количественная оценка полос была выполнена с помощью программного обеспечения ImageJ на основе их интегрированной плотности на площадь.

Ex vivo Генная терапия LMNA

Первичные фибробласты выделяли из кончиков хвостов взрослых мышей указанных генотипов. 45000 клеток засевали на лунку 12-луночного планшета за день до заражения их лентивирусами, которые экспрессируют репортер mCherry и индивидуальные gRNA-Lmna 1 и 2 или ложную gRNA. mCherry-позитивные клетки в культуре визуально подсчитывали под микроскопом, по крайней мере, в трех полях зрения, чтобы оценить инфекционность. Достигнута инфекционность более 65%.После заражения не производился отбор или сортировка клеток. Клетки пассировали по крайней мере один раз перед лизированием для иммуноблоттинга. Они были обработаны для вестерн-блоттинга так же, как и образцы органов, за исключением того, что дезоксихолат натрия был исключен из буфера RIPA, используемого для их лизиса.

Гистологические анализы

Для гистологических анализов мышей 19 недель указанных генотипов перфузировали сначала PBS, затем 10% формалином, за исключением того, что для дуг аорты использовали 4% параформальдегид (PFA) вместо 10% формалина.Все органы инкубировали в 10% формалине при комнатной температуре в течение 2 дней, за исключением того, что дуги аорты инкубировали в 4% PFA при 4 ° C в течение 16 часов. Все образцы хранили в 70% этаноле при 4 ° C до заливки парафином и разделения на срезы. Срезы анализировали с окрашиванием гематоксилином и эозином. Площадь средних слоев и количество содержащихся в них ядер рассчитывали с помощью программы Image J 1.52c. Были проанализированы 3-5 мышей от каждого состояния. Общее количество слайдов для количественного определения указано в подписях к соответствующим рисункам.

Физиологические анализы

Для анализа частоты сердечных сокращений мышей анестезировали 2,5% изофлураном и контролировали с помощью прибора для сбора данных Power Lab (ADInstruments). Обработка и анализ данных выполнялись с помощью LabChart8 (ADInstruments).

Для испытания силы захвата измеритель натяжения, измеряющий силу в ньютонах, был установлен горизонтально на платформе. Мышь держали за хвост и позволяли ухватиться за натяжную планку обеими лапами, прежде чем медленно оторваться от планки, пока ее захват не был сломан.Для каждой группы использовали 5 взрослых мышей-самок и 5 взрослых мышей-самцов (возраст 16-18 недель) (дикий тип, обработанная гомозиготная прогерия и отрицательный контроль). Каждую мышь подвергали тесту по 5 раз на прочность передних и задних конечностей. Каждая оценка на графике соответствует 25 показаниям, полученным от 5 животных, измеренных 5 раз.

Произвольная активность беговых колес регистрировалась с помощью низкопрофильных беспроводных беговых колес, подключенных к компьютеру через беспроводной концентратор, и анализировалась с помощью прилагаемого программного обеспечения (Med Associates Inc., Каталожный номер: ENV-047). Животным позволяли адаптироваться к колесам в течение не менее 22 часов перед включением их активности в оценки. Действия были интегрированы только после того, как мыши привыкли к колесам, что было определено по активности, показывающей циркадную корреляцию (активность в ночное время). 1 из 27 проанализированных мышей не проявили интереса к беговым колесам, что было определено по небольшим спорадическим пикам активности без циркадной корреляции. Эта мышь была исключена из исследования.Были включены все мыши, которые показали даже низкую активность, но с циркадной корреляцией.

Подготовка библиотеки ДНК и глубокое секвенирование

Вложенная ПЦР была проведена для подготовки библиотек ДНК для глубокого секвенирования. Те же праймеры Lmna F и Lmna R, использованные в этой процедуре, также были применены к этой процедуре. Их использовали для первого раунда амплификации процедуры вложенной ПЦР с ограниченными циклами ПЦР с использованием 100 нг геномной ДНК. Этот продукт ПЦР использовали для второго раунда амплификации процедуры вложенной ПЦР с использованием пар праймеров, содержащих последовательности адаптеров для глубокого секвенирования (Lmna-1-адаптер-F1 и Lmna-1-адаптер-R1 или Lmna-2-адаптер- F3 и Lmna-2-адаптер-R3).Вложенный продукт ПЦР очищали с использованием набора для очистки QIAquick PCR Purification Kit (QIAGEN). Этот очищенный препарат библиотеки ДНК подвергали глубокому секвенированию, как в опубликованном протоколе 19 . Последовательности праймеров перечислены в дополнительной таблице 1

Анализ секвенирования РНК

Общую РНК выделяли из первичных фибробластов кончика хвоста указанных генотипов и обработок. гРНК доставляли в культивируемые клетки лентивирусными векторами. Клетки гомогенизировали на спин-колонках Qiashredder (Qiagen) и обрабатывали с помощью RNeasy Mini Kit (Qiagen) для выделения их общей РНК.Оценка качества, конструирование библиотеки и секвенирование (многониточная мРНК, HiSeq SE50) были выполнены Центром секвенирования нового поколения Центра геномной медицины Хелмсли при Институте Солка. Биоинформатический анализ был выполнен Центром интегративной геномики и биоинформатики Разави Ньюмана в Институте Солка. Последовательные чтения были проверены на качество с помощью FASTQC и сопоставлены с геномом мыши mm10 с использованием STAR 21 версии 2.5.1b. Сопоставление было выполнено с использованием параметров по умолчанию (до 10 несоответствий на чтение и до 9 ячеек с несколькими сопоставлениями на чтение).Нормализованные фрагменты на килобазу на миллион отображенных считываний (FPKM) были количественно определены по всем аннотированным экзонам. Нормализованные плотности чтения были визуализированы с помощью браузера генома UCSC.

Антитела

Следующие антитела были использованы для иммуноблоттинга в указанном разведении: Anti-LAMIN A / C (N-18) 1: 100 (SantaCruz, каталожный номер: sc6215), Anti-LAMIN A / C (E-1 ) 1: 100 (SantaCruz, № по каталогу: sc376248), анти-β-актин 1: 600 (SantaCruz, № по каталогу: sc47778), анти-α-тубулин 1: 750 (Calbiochem, № по каталогу: CP06).Вторичные антитела, конъюгированные с HRP, представляли собой козьи антитела 1: 500 (Novex, Каталожный номер A15909), антимышиные 1: 1000 (Cell Signaling, Каталожный номер 7076)

Статистический анализ

Среднее (среднее), стандартная ошибка среднее (SEM) и статистическая значимость были рассчитаны с помощью непарного теста Стьюдента t (), множественного теста t () или однофакторного дисперсионного анализа ANOVA с поправкой Бонферрони (и) и логрангового теста (Mantel-Cox). () с помощью Microsoft Excel или GraphPad Prism. Значение p <0.05 считалось значимым (* p <0,05, ** p <0,01, *** p <0,001), p значения ≥0,05 были обозначены как статистически не значимые (нс)

Условия — Транго

Ваше согласие
Используя наш сайт, вы соглашаетесь с нашими условиями.

Заявление о доступности

Great Trango Holdings, Inc. («GTHI»), владелец брендов Trango и eGrip, понимает трудности, с которыми сталкиваются люди с ограниченными возможностями, и оказывает поддержку спортсменам и группам с ограниченными возможностями на протяжении многих лет.GTHI стремится к тому, чтобы наши клиенты-инвалиды имели равные возможности доступа ко всем тем же материальным ресурсам, информации, сообщениям и услугам, которые доступны нашим клиентам без инвалидности через наши веб-сайты trango.com и e-grips.com, и блоги. Чтобы наши веб-сайты были доступны для людей с ограниченными возможностями, GTHI стремится соблюдать применимые законы, в том числе Закон об американцах с ограниченными возможностями («ADA»), и руководящие принципы, в том числе Рекомендации Консорциума World Wide Web по обеспечению доступности веб-контента («WCAG»). 2.0 со стандартами доступности до уровня AA.

Если у вас возникнут какие-либо трудности при использовании или доступе к какой-либо части наших веб-сайтов, пожалуйста, немедленно позвоните нам по телефону 303.530.3035 или напишите нам по адресу [email protected] или [email protected], и мы будем работать с вами, чтобы гарантировать, что Вы имеете полный и равноправный доступ к интересующей вас информации и при желании можете приобретать наши продукты. Кроме того, свяжитесь с нами по телефону 303.530.3035, [email protected] или [email protected], если у вас есть какие-либо предложения или отзывы о доступности наших веб-сайтов.

Действует немедленно.

Добро пожаловать на веб-сайты Great Trango Holdings, Inc. («GTHI») в Интернете: www.trango.com и www.e-grips.com. GTHI и / или ее аффилированные лица («Компания», «мы» или «нас») предоставляют вам доступ к веб-сайту и его функции в соответствии со следующими Условиями использования (совместно именуемые «Условия»). ВНИМАТЕЛЬНО ПРОЧИТАЙТЕ ДАННЫЕ УСЛОВИЯ ПЕРЕД ИСПОЛЬЗОВАНИЕМ ЛЮБОГО ВЕБ-САЙТА КОМПАНИИ, включая, помимо прочего, trango.com и e-grips.com. ИСПОЛЬЗУЯ ЛЮБОЙ ВЕБ-САЙТ КОМПАНИИ, ВЫ СОГЛАШАЕТЕСЬ СОБЛЮДАТЬ ДАННЫЕ УСЛОВИЯ ЮРИДИЧЕСКИ; ЕСЛИ ВЫ НЕ СОГЛАСНЫ, НЕ ИСПОЛЬЗУЙТЕ ДАННЫЙ ВЕБ-САЙТ. ОБРАТИТЕ ВНИМАНИЕ, ЧТО НИЖЕ РАЗДЕЛ 18 СОДЕРЖИТ ПОЛОЖЕНИЯ, ТРЕБУЮЩИЕ ОБЯЗАТЕЛЬНОГО АРБИТРАЖА ДЛЯ РАЗРЕШЕНИЯ СПОРОВ, А ТАКЖЕ ОТКАЗ ОТ ПРИСЯЖНЫХ И КЛАССНЫХ ИСШ, КОТОРЫЕ ВЛИЯЮТ НА ВАШИ ЮРИДИЧЕСКИЕ ПРАВА. ПОЖАЛУЙСТА, ПРОЧИТАЙТЕ. Компания может в будущем изменять или пересматривать настоящие Условия по своему усмотрению без какого-либо уведомления. Когда мы вносим изменения, мы обновим эти Условия здесь. Использование вами этого Веб-сайта и любых других Веб-сайтов Компании, включая, помимо прочего: www.trango.com, www.e-grips.com и любые другие веб-сайты, принадлежащие, управляемые или поддерживаемые Компанией в настоящее время или в будущем (совместно именуемые « Веб-сайты ») после любого такого изменения означает ваше согласие с пересмотренными Условиями.Вам следует периодически проверять эти Условия на предмет изменений. Веб-сайты являются собственностью Компании и ее лицензиаров.

Используя Веб-сайты, вы подтверждаете, что вам исполнилось 18 лет или вы достигли минимального установленного законом возраста для заключения договора в юрисдикции, в которой вы просматриваете Веб-сайты. Веб-сайты и информация, содержащаяся в них, предназначены только для вашего личного некоммерческого использования. Пока вы полностью соблюдаете настоящие Условия, Компания предоставляет вам личные, неисключительные, непередаваемые, ограниченные права на вход и использование Сайтов.

  1. Контент веб-сайта . Весь текст, графика, интерфейсы, фотографии, товарные знаки, логотипы, звуки, музыка, изображения и компьютерный код (совместно именуемые «Контент»), включая, помимо прочего, дизайн, структуру, выбор, координацию, выражение, «внешний вид и чувствовать »и размещение такого Содержимого, содержащегося на Веб-сайтах, принадлежит, контролируется или лицензируется Компанией или ей и защищается законами о внешнем виде, авторском праве, патентах и ​​товарных знаках, а также различными другими законами о правах интеллектуальной собственности и недобросовестной конкуренции.За исключением случаев, прямо предусмотренных в настоящих Условиях, никакая часть Веб-сайтов и никакой Контент не могут быть скопированы, воспроизведены, переизданы, загружены, опубликованы, публично показаны, закодированы, переведены, переданы или распространены любым способом на любой другой компьютер, сервер, веб-сайт или другой носитель для публикации или распространения или для любого коммерческого предприятия без явного предварительного письменного согласия Компании. Вы можете использовать Контент и информацию о продуктах и ​​услугах Компании (например, спецификации, изображения продуктов, технические характеристики, статьи и аналогичные материалы) только с Веб-сайтов, при условии, что вы (1) не удалите какие-либо уведомления об авторских правах или других правах собственности из любого из материалов, (2) использовать такую ​​информацию только для личного информационного использования и не продавать и не изменять Контент, а также воспроизводить, отображать, публично исполнять, распространять или иным образом использовать Контент в любых общественных или коммерческих целях , (3) не использовать Контент таким образом, который подразумевает связь с Компанией или какими-либо нашими продуктами, услугами или брендами, и (4) не делать никаких дополнительных заявлений или гарантий в отношении таких материалов

  1. Сторонние ссылки. Веб-сайты могут содержать ссылки на сторонние веб-сайты («Связанные веб-сайты»). Любые такие Связанные веб-сайты предоставляются исключительно для ознакомления и для вашего удобства. Компания не поддерживает и не делает никаких заявлений или гарантий относительно содержания или точности таких Связанных веб-сайтов. Такие Связанные веб-сайты не находятся под контролем Компании, и Компания не несет ответственности и не делает никаких подтверждений или заявлений в отношении информации или материалов, содержащихся на таких Связанных веб-сайтах.Если вы получаете доступ к каким-либо связанным веб-сайтам, вы делаете это на свой страх и риск. КОМПАНИЯ НЕ НЕСЕТ ОТВЕТСТВЕННОСТИ ЗА ЛЮБЫЕ УБЫТКИ ИЛИ УЩЕРБ, понесенные ВАМИ В РЕЗУЛЬТАТЕ ВАШИХ ОТНОШЕНИЙ С ЛЮБЫМИ СТОРОННИМИ ИЛИ СВЯЗАННЫМИ ВЕБ-САЙТАМИ, ЛЮБЫМИ ТОРГОВЛЯМИ ИЛИ ОПЕРАТОРАМИ ТРЕТЬИХ ИЛИ СВЯЗАННЫХ ВЕБ-САЙТОВ ИЛИ ЛЮБЫМ ДРУГИМ ЛИЦОМ, С КОТОРОМ ЛЮБАЯ СДЕЛКА.

  1. Ограниченная лицензия на доступ к веб-сайтам. Пока вы соблюдаете настоящие Условия, Компания предоставляет вам ограниченную лицензию на доступ и личное использование Сайтов.Компания также предоставляет вам ограниченное, отзывное и неисключительное право на создание ссылки на домашние страницы веб-сайтов при условии, что ссылка не изображает Компанию, ее продукты или услуги в ложном, вводящем в заблуждение, негативном, унизительном или в противном случае оскорбительное дело. Вы не можете использовать какой-либо логотип компании или другое собственное изображение или товарный знак в качестве части ссылки без нашего явного письменного разрешения. Без явного предварительного письменного согласия Компании эта ограниченная лицензия НЕ позволяет вам : (1) воспроизводить, дублировать, копировать, продавать, перепродавать, посещать или каким-либо иным образом использовать или использовать в любых коммерческих целях все или любые часть Сайтов или их Контент; (2) собирать и / или использовать списки, описания или цены продуктов; (3) любое производное использование Сайтов или их Содержимого; (4) загружать или копировать информацию, включая, помимо прочего, информацию об учетной записи, в интересах себя или любой третьей стороны; (5) загружать или изменять все или любую часть Веб-сайтов или их Содержимого; (6) любое использование интеллектуального анализа данных, роботов или аналогичных инструментов сбора и извлечения данных; (7) использовать любые мета-теги или любые другие скрытые данные с использованием названия или товарных знаков Компании; (8) для кадрирования или фиксации каких-либо товарных знаков, логотипов или другой информации, являющейся собственностью (например,g., текст, фотографии, изображения, макет страницы и т. д.) на Веб-сайтах и ​​/ или (9) любое другое несоответствующее или ненадлежащее использование Веб-сайтов или их Содержимого. Любое несанкционированное использование вами любого из этих Условий автоматически прекращает действие ограниченной лицензии, предоставленной вам Компанией на использование Веб-сайтов или их Содержимого.

  1. Ваша учетная запись и обязательства . Если вы используете Веб-сайты, вы несете единоличную ответственность за сохранение конфиденциальности информации о вашей учетной записи (включая, помимо прочего, ваш пароль и информацию о кредитной карте) и за ограничение доступа к вашему компьютеру.Вы соглашаетесь принять на себя полную ответственность за все действия, которые происходят под вашей учетной записью или паролем, и вы соглашаетесь немедленно уведомлять Компанию о любом несанкционированном использовании вашей учетной записи или пароля или любом другом нарушении безопасности. Вы понимаете и соглашаетесь с тем, что вы можете нести ответственность за убытки, понесенные Компанией и / или любым другим пользователем или посетителем Сайтов из-за того, что кто-то другой использовал ваше имя пользователя, пароль или учетную запись вашей Компании, если вы не сможете обеспечить безопасность и конфиденциальность информации своей учетной записи. .

Вы не можете использовать имя пользователя, пароль или учетную запись Компании другого лица в любое время без явного разрешения и согласия владельца этого имени пользователя, пароля или учетной записи Компании. Если вам меньше 18 лет, вы можете использовать Веб-сайты Компании только с участием и с согласия одного из родителей или опекуна. Компания не несет ответственности за любые убытки или ущерб, возникшие в результате невыполнения вами этих обязательств. Вы соглашаетесь не выдавать себя за какое-либо физическое или юридическое лицо или искажать свою личность или принадлежность к любому физическому или юридическому лицу, включая использование имени пользователя, пароля или другой информации учетной записи другого лица, или имени, внешности, голоса, изображения или фотографии другого лица.Вы также соглашаетесь уведомить Компанию по адресу [email protected] и / или [email protected] сразу же после обнаружения любого несанкционированного использования вашего имени пользователя, пароля, другой информации учетной записи или любого другого нарушения безопасности, о котором вам стало известно. связанные с любыми веб-сайтами Компании. Компания может приостановить или прекратить действие вашей учетной записи и использования вами любых Веб-сайтов, если вы не соблюдаете настоящие Условия, и Компания оставляет за собой право отказать в обслуживании, закрыть любую учетную запись, удалить или изменить Контент и / или отменить заказы по собственному усмотрению Компании.

Использование вами Веб-сайтов обусловлено вашим согласием соблюдать все применимые законы в связи с использованием вами Веб-сайтов, настоящих Условий и таких дополнительных ограничений, которые могут быть изложены в любом письменном или отображаемом на экране уведомлении от Компании. Кроме того, вы соглашаетесь с тем, что вся информация, которую вы предоставляете Компании в связи с любой покупкой, транзакцией или другим взаимодействием с Компанией на Веб-сайтах, будет точной, полной и актуальной. Вы соглашаетесь оплачивать все сборы и любые применимые налоги, понесенные вами и / или любыми другими пользователями вашей кредитной карты, дебетовой карты или другого способа оплаты, используемого в связи с любой покупкой или транзакцией с Компанией, по ценам, действующим на момент возникновения таких сборов. понесены.

Используя Веб-сайты, вы соглашаетесь не нарушать, не пытаться нарушать или помогать другим в нарушении или попытках нарушить безопасность Веб-сайтов, включая, помимо прочего, выполнение или попытку любого из следующего: (1) зондирование, сканирование, или тестирование уязвимости Веб-сайтов, их серверов, систем или сетей, (2) нарушение мер аутентификации / безопасности, (3) вход на сервер или учетную запись или доступ к данным, к которым у вас нет прав доступа, (4) вмешательство в какие-либо с помощью сервисов Сайтов любому пользователю, хосту или сети любыми средствами, включая вирусы, спам, перегрузку и т. д.и / или (5) отправка нежелательной электронной почты и / или подделка заголовков в любом электронном письме или публикации. Вы соглашаетесь с тем, что Компания может по своему собственному усмотрению и без предварительного уведомления прекратить ваш доступ к Сайтам и / или заблокировать ваш доступ к Сайтам в будущем по любой причине, включая, помимо прочего: (1) если мы определим, что вы нарушили настоящие Условия или другие соглашения или руководящие принципы, связанные с использованием вами Веб-сайтов, (2) запросы правоохранительных органов или других государственных органов, (3) ваш запрос, (4) прекращение или существенное изменение Веб-сайтов или любой услуги предлагаемые на Веб-сайтах или через них, или (5) технические проблемы или проблемы.Вы соглашаетесь с тем, что Компания не будет нести ответственности перед вами или любой третьей стороной за прекращение вашего доступа к Сайтам. Вы также соглашаетесь с тем, что любое нарушение вами настоящих Условий будет представлять собой как минимум незаконную и недобросовестную деловую практику и нанесет непоправимый ущерб Компании, для которого денежный ущерб может быть недостаточным, и вы соглашаетесь с тем, что Компания получит любой судебный запрет или судебный запрет на справедливой основе, который Компания считает это необходимым или целесообразным в таких обстоятельствах. Если Компания инициирует какой-либо судебный иск против вас в результате нарушения вами настоящих Условий, вы соглашаетесь с тем, что Компания будет иметь право взыскать с вас, и вы соглашаетесь оплатить все разумные гонорары Компании адвокатам и расходы, связанные с такими действиями, в в дополнение к любым другим льготам, предоставленным Компании.Эти средства правовой защиты дополняют любые другие средства правовой защиты, которые Компания может иметь по закону или по праву справедливости.

  1. Электронные коммуникации. Когда вы посещаете веб-сайты компании или отправляете нам электронные письма, вы общаетесь с нами в электронном виде и соглашаетесь получать от нас сообщения в электронном виде. Мы будем связываться с вами по электронной почте и / или размещая уведомления на Веб-сайтах. Вы соглашаетесь с тем, что все соглашения, уведомления, раскрытия и другие сообщения, которые мы предоставляем вам в электронном виде, удовлетворяют любым юридическим требованиям, согласно которым такие сообщения должны быть в письменной форме.

  1. Конфиденциальность. Компания использует свои собственные и сторонние файлы cookie, чтобы улучшить ваш опыт и наши услуги, анализируя, как люди используют наш веб-сайт. Продолжая использовать веб-сайты, вы соглашаетесь с использованием файлов cookie. Ознакомьтесь с Политикой конфиденциальности Компании по адресу http://trango.com/t-privacy.aspx и https://e-grips.com/pages/terms-and-conditions, которая применяется к использованию вами Веб-сайтов и является включены в настоящие Условия и являются их частью посредством этой ссылки.Кроме того, используя Веб-сайты, вы признаете и соглашаетесь с тем, что передача данных через Интернет никогда не бывает полностью конфиденциальной или безопасной. Вы понимаете, что любое сообщение или информация, которые вы отправляете на Веб-сайты, могут быть прочитаны или перехвачены другими лицами, даже если есть специальное уведомление о том, что конкретная передача (например, информация о кредитной карте) зашифрована.

  1. Авторские права . Весь Контент, включенный на Сайты, такой как текст, изображения, графика, логотипы, значки, аудио- и видеоклипы, цифровые загрузки, компиляции данных и программное обеспечение, а также компиляция всего Контента на этих Сайтах является исключительной собственностью Компании. лицензиарами или поставщиками и защищены Законом США об авторском праве и международными законами об авторском праве.Ничто из заявленного или подразумеваемого на Веб-сайтах не дает вам каких-либо лицензий или законных прав в соответствии с какими-либо авторскими правами Компании или любой третьей стороны. Федеральные законы и законы штата запрещают вам копировать, копировать, воспроизводить, транслировать, изменять, редактировать, распространять, отображать, публиковать, выполнять, распространять или передавать любой Контент или часть Веб-сайтов для любых целей.

  1. Товарные знаки. Все товарные знаки, логотипы и знаки обслуживания («Знаки»), отображаемые на Веб-сайтах, принадлежат Компании и / или третьим лицам.Вам запрещено использовать какие-либо Знаки без явного предварительного письменного разрешения Компании или такой третьей стороны. Если вам нужна информация о получении разрешения Компании на использование Контента на вашем веб-сайте, напишите нам по адресу [email protected] или [email protected] Некоторые из зарегистрированных в США товарных знаков, принадлежащих Компании, включают, помимо прочего: TRANGO, EGRIPS, E-GRIPS, BE A CLIMBER, ROCK PRODIGY, VERGO, FRD и EXTRAORDINARY CLIMBING GEAR. Все прочие Знаки на наших Веб-сайтах и ​​другие знаки.com графика, логотипы, заголовки страниц, значки, сценарии и названия служб являются товарными знаками, зарегистрированными товарными знаками и / или фирменным стилем Компании в США и / или других странах и принадлежат исключительно Компании. Товарные знаки и фирменный стиль Компании не могут быть использованы в связи с какими-либо продуктами или услугами, не принадлежащими Компании, каким-либо образом, который может вызвать замешательство среди клиентов, или каким-либо образом, унижающим или дискредитирующим Компанию. Все другие товарные знаки, не принадлежащие Компании, которые появляются на Веб-сайтах, являются собственностью их соответствующих владельцев, которые могут быть аффилированы, связаны или спонсированы Компанией.Использование или ненадлежащее использование этих товарных знаков или любых материалов, за исключением разрешенных в настоящем документе, прямо запрещено, и ничто, указанное или подразумеваемое на Веб-сайтах, не дает вам каких-либо лицензий или прав в соответствии с любым патентом, авторским правом или товарным знаком Компании или любой третьей стороны.

  1. Материалы, которые вы публикуете на веб-сайтах. Вы можете публиковать обзоры, комментарии, фотографии и другие материалы, отправлять электронные письма и другие электронные сообщения, а также отправлять предложения, комментарии, вопросы или другую информацию, если материалы не являются незаконными, непристойными, угрожающими, дискредитирующими, и / или являются нежелательными по собственному усмотрению Компании, и при условии, что материалы не нарушают чью-либо частную жизнь, не причиняют иным образом вреда кому-либо или нарушают права интеллектуальной собственности.Кроме того, публикуемые вами материалы не могут состоять или содержать программные вирусы, политические кампании, коммерческие предложения, письма счастья, массовые рассылки или любую форму спама. Вы не можете использовать ложный адрес электронной почты, выдавать себя за какое-либо физическое или юридическое лицо или иным образом вводить в заблуждение относительно происхождения любых материалов. Если вы публикуете или отправляете материал, вы предоставляете Компании неисключительное, бесплатное, бессрочное, безотзывное и полностью сублицензируемое право на использование, воспроизведение, изменение, адаптацию, публикацию, перевод, создание производных работ, распространение и отображение такие материалы по всему миру в любых СМИ. Вы предоставляете Компании и ее сублицензиатам право использовать имя, указанное вами в связи с такими материалами, если они захотят. Вы заявляете и гарантируете (1), что вы владеете или иным образом контролируете все права на публикуемые вами материалы; (2) материалы точны; (3) использование предоставленных вами материалов не нарушает эту политику и не причиняет вреда какому-либо физическому или юридическому лицу; и (4) что вы возместите Компании все претензии и / или ущерб, понесенный ею в результате использования вами материалов.Компания оставляет за собой право, но не обязательство, отслеживать и редактировать или удалять любые действия или материалы по своему собственному усмотрению. Компания прямо отказывается от ответственности, не несет ответственности и не принимает на себя никаких обязательств в отношении любых материалов, размещенных вами или любой третьей стороной.

  1. Жалобы на нарушение авторских прав. Компания уважает интеллектуальную собственность других лиц. Политика Компании, в зависимости от обстоятельств и по собственному усмотрению, заключается в прекращении действия учетных записей пользователей, нарушающих авторские права третьих лиц.Если вы считаете, что ваша работа была скопирована с нарушением авторских прав, свяжитесь с нами по телефону:

Great Trango Holdings, Inc.

1215 Distel Drive, Suite B

Лафайет, Колорадо 80026

Телефон: 1-800-860-3653

Эл. Почта: [email protected]

и включить следующую информацию в письменной форме, которая требуется в соответствии с Законом о защите авторских прав в цифровую эпоху («DMCA»):

(1) Подробное описание работы, защищенной авторским правом, права на которую, по вашему мнению, были нарушены.

(2) Описание того, где материал, который, по вашему мнению, нарушает авторские права, находится на Веб-сайтах, разумно достаточное для того, чтобы позволить Компании найти этот материал.

(3) Ваш адрес, номер телефона и адрес электронной почты.

(4) Ваше заявление о том, что вы добросовестно полагаете, что оспариваемое использование не разрешено владельцем авторских прав, его агентом или законом.

(5) Заявление, сделанное вами под страхом наказания за лжесвидетельство, о том, что приведенная выше информация в вашем уведомлении является точной и что вы являетесь владельцем авторских прав или уполномочены действовать от имени владельца авторских прав.

(6) Ваша физическая или электронная подпись, если вы являетесь владельцем авторских прав или уполномочены действовать от имени владельца авторских прав, или физическая или электронная подпись владельца или лица, уполномоченного действовать от имени владельца авторских прав, который были предположительно нарушены.

Вы признаете, что если вы не соблюдаете все вышеперечисленные требования, ваше уведомление DMCA может быть недействительным. См. 17 U.S.C. § 512 для получения дополнительной информации об уведомлениях DMCA и DMCA.

  1. Риск потери. Все товары, которые вы заказываете и покупаете у Компании через Веб-сайты, транспортируются и доставляются независимым перевозчиком, не связанным с Компанией. Право собственности на приобретенные вами товары, а также риск их потери переходят к вам после того, как Компания доставит товары перевозчику.В случае утери посылки, пожалуйста, свяжитесь с отделом обслуживания клиентов Компании по адресу [email protected] и / или [email protected], чтобы помочь с претензией по доставке.

  1. Описание и доступность продукта. Хотя Компания пытается точно описать свои продукты и их доступность, Компания не заявляет и не гарантирует, что ее описания продуктов, их наличие и / или любой другой Контент не содержат ошибок, являются полными, актуальными или надежными.Обратите внимание, что цвета продуктов компании могут отличаться от реальных на мониторе вашего компьютера. Большинство продуктов компании доступны для просмотра в розничных магазинах компании по всему миру. Если продукт, предлагаемый самой Компанией, не соответствует описанию, единственное средство правовой защиты — вернуть его в неиспользованном состоянии.

  1. Отказ от гарантий и ограничение ответственности. Компания не делает никаких заявлений и не дает никаких гарантий относительно точности, надежности, полноты или своевременности Содержимого или результатов, которые должны быть получены от использования Веб-сайтов и Содержимого. ЛЮБОЕ ИСПОЛЬЗОВАНИЕ ВЕБ-САЙТОВ И КОНТЕНТА НА ВАШ СОБСТВЕННЫЙ РИСК. На Веб-сайты периодически вносятся изменения, которые Компания может вносить в любое время по своему собственному усмотрению. Некоторый Контент на Веб-сайтах может быть предоставлен третьими сторонами, и Компания прямо снимает с себя всякую ответственность за любой такой Контент, предоставленный третьими сторонами.

13.1. Сайты . Вы используете веб-сайты компании на свой страх и риск. Если вы недовольны каким-либо Контентом или другим контентом Веб-сайтов Компании или настоящими Условиями, единственным средством правовой защиты является прекращение использования Веб-сайтов Компании . ВЕБ-САЙТЫ И ВСЯ ИНФОРМАЦИЯ, СОДЕРЖАНИЕ, МАТЕРИАЛЫ, ПРОГРАММНОЕ ОБЕСПЕЧЕНИЕ И УСЛУГИ, ВКЛЮЧЕННЫЕ ИЛИ Иным образом ДОСТУПНЫЕ ДЛЯ ВАС ЧЕРЕЗ ВЕБ-САЙТЫ, ПРЕДОСТАВЛЯЮТСЯ КОМПАНИЕЙ НА УСЛОВИЯХ «КАК ЕСТЬ» И «ПО ДОСТУПНОСТИ», ЕСЛИ ИНАЧЕ НЕ УКАЗАНО ИНАЧЕ.КОМПАНИЯ НЕ ПРЕДОСТАВЛЯЕТ НИКАКИХ ЗАЯВЛЕНИЙ ИЛИ ГАРАНТИЙ ЛЮБОГО РОДА, ЯВНЫХ ИЛИ ПОДРАЗУМЕВАЕМЫХ, В ОТНОШЕНИИ РАБОТЫ ВЕБ-САЙТОВ ИЛИ ИНФОРМАЦИИ, СОДЕРЖАНИЯ, МАТЕРИАЛОВ, ПРОГРАММНОГО ОБЕСПЕЧЕНИЯ ИЛИ УСЛУГ, ВКЛЮЧЕННЫХ ИЛИ ИНЫМ ОБРАЗОМ, ПРЕДОСТАВЛЕННЫМ ДЛЯ ВАС ИЛИ ДОСТУПНЫМИ ДЛЯ ВАС ЧЕРЕЗ ВЕБ-САЙТЫ ПОДПИСАНО УПОЛНОМОЧЕННЫМ ПРЕДСТАВИТЕЛЕМ КОМПАНИИ. ВЫ ЯВНО СОГЛАШАЕТЕСЬ, ЧТО ВЫ ИСПОЛЬЗУЕТЕ ВЕБ-САЙТЫ НА СВОЙ ИСКЛЮЧИТЕЛЬНЫЙ РИСК. КОМПАНИЯ ОТКАЗЫВАЕТСЯ ОТ ВСЕХ ГАРАНТИЙ, ЯВНЫХ ИЛИ ПОДРАЗУМЕВАЕМЫХ, ВКЛЮЧАЯ, НО НЕ ОГРАНИЧИВАЯСЯ, ПОДРАЗУМЕВАЕМЫЕ ГАРАНТИИ ПРИГОДНОСТИ ДЛЯ ОПРЕДЕЛЕННОЙ ЦЕЛИ, ДОПУСТИМО ПРИМЕНИМЫМ ЗАКОНОДАТЕЛЬСТВОМ.ХОТЯ КОМПАНИЯ ПРИНИМАЕТ КОММЕРЧЕСКИ РАЗУМНЫЕ МЕРЫ ДЛЯ ЗАЩИТЫ ПЕРСОНАЛЬНОЙ ИНФОРМАЦИИ СВОИХ КЛИЕНТОВ, КОМПАНИЯ НЕ ГАРАНТИРУЕТ, ЧТО (1) ВЕБ-САЙТЫ, (2) ИНФОРМАЦИЯ, СОДЕРЖАНИЕ, МАТЕРИАЛЫ, ПРОГРАММНОЕ ОБЕСПЕЧЕНИЕ ИЛИ УСЛУГИ, ПРЕДОСТАВЛЕННЫЕ ДЛЯ ВАС 3) СЕРВЕРЫ ВЕБ-САЙТОВ ИЛИ (4) ЭЛЕКТРОННАЯ ПОЧТА НЕ СОДЕРЖИТ ВИРУСОВ ИЛИ ДРУГИХ ВРЕДНЫХ КОМПОНЕНТОВ. ИСКЛЮЧАЯ УМЫШЛЕННОЕ НЕПРАВИЛЬНОЕ ПОВЕДЕНИЕ КОМПАНИИ, КОМПАНИЯ ЯВНО ОТКАЗЫВАЕТСЯ И НЕ НЕСЕТ ОТВЕТСТВЕННОСТИ ЗА ЛЮБЫЕ УБЫТКИ ЛЮБОГО РОДА, ВЫЗВАННЫЕ ИЛИ СВЯЗАННЫЕ С ИСПОЛЬЗОВАНИЕМ ВАМИ ВЕБ-САЙТОВ ИЛИ ИЗ ЛЮБОЙ ИНФОРМАЦИИ, КОНТЕНТА, МАТЕРИАЛОВ ИЛИ ДОПОЛНИТЕЛЬНОГО ПРОГРАММНОГО ОБЕСПЕЧЕНИЯ ВЫ ЧЕРЕЗ ВЕБ-САЙТЫ, ЕСЛИ ИНОЕ НЕ УКАЗАНО В ПИСЬМЕННОМ СЧЕТЕ, ПОДПИСАННОМ УПОЛНОМОЧЕННЫМ ПРЕДСТАВИТЕЛЕМ КОМПАНИИ.

13.2. Продукция . Гарантия на продукцию компании предоставляется первоначальному розничному покупателю на отсутствие дефектов материалов и изготовления, как описано в материалах, прилагаемых к продуктам. Все гарантийные элементы должны быть оценены Компанией. Решения будут приниматься исключительно по усмотрению Гарантийного отдела Компании. Если на какой-либо товар распространяется наша гарантийная политика (см. Ниже), после гарантийного осмотра Компания сначала попытается отремонтировать продукт вашей Компании.Если ремонт невозможен или не является надежным, Компания будет стремиться заменить продукт таким же или аналогичным продуктом при наличии. Если вы покупаете продукт Компании на каких-либо веб-сайтах Компании, которые, по вашему мнению, являются дефектными, свяжитесь с нашим отделом обслуживания клиентов по адресу [email protected] и / или [email protected] и договоритесь о возврате продукта нам вместе с квитанцией. и документ, подтверждающий покупку, с указанием даты покупки. Компания проверит и, если будет обнаружена проблема с гарантией, отремонтирует или заменит продукт по своему собственному усмотрению.Если Компания определит, что у возвращенного продукта нет гарантийных вопросов, продукт будет возвращен вам с пояснением. ОТВЕТСТВЕННОСТЬ КОМПАНИИ ПО ДАННОЙ ОГРАНИЧЕННОЙ ГАРАНТИИ ЯВНО ОГРАНИЧИВАЕТСЯ ИСКЛЮЧИТЕЛЬНО ТАКИМ РЕМОНТОМ ИЛИ ЗАМЕНОЙ. ПО ИСКЛЮЧЕНИИ ГАРАНТИЙНОГО СРОКА КОМПАНИЯ НЕ НЕСЕТ ОТВЕТСТВЕННОСТИ ПО ДАННОЙ ОГРАНИЧЕННОЙ ГАРАНТИИ ИЛИ ИНЫМ ОБРАЗОМ. ДАННАЯ ОГРАНИЧЕННАЯ ГАРАНТИЯ ЯВНО ИСКЛЮЧАЕТ СЛЕДУЮЩЕЕ: (1) УБЫТКИ ИЗ-ЗА НОРМАЛЬНОГО ИСПОЛЬЗОВАНИЯ И ИЗНОСА; (2) УБЫТКИ ИЗ-ЗА ЗЛОУПОТРЕБЛЕНИЯ ИЛИ АВАРИЙ; (3) ПРОДУКТЫ КОМПАНИИ, КОТОРЫЕ БЫЛИ РАЗРЕШЕНЫ ИЛИ ЛЮБОЙ СПОСОБ ИЗМЕНЕНИЯ; И (4) СООТВЕТСТВИЕ ЛЮБОМУ ПРОДУКТУ КОМПАНИИ.НАСТОЯЩАЯ ОГРАНИЧЕННАЯ ГАРАНТИЯ ЗАМЕНЯЕТ ВСЕ ДРУГИЕ ГАРАНТИИ, ЯВНЫЕ ИЛИ ПОДРАЗУМЕВАЕМЫЕ, И ЗА ИСКЛЮЧЕНИЕМ ИНОГО УКАЗАННОГО ВЫШЕ, КОМПАНИЯ НЕ ДАЕТ НИКАКИХ ГАРАНТИЙ, ЯВНЫХ ИЛИ ПОДРАЗУМЕВАЕМЫХ, ВКЛЮЧАЯ БЕЗ ОГРАНИЧЕНИЙ ЛЮБОЙ ГАРАНТИИ, ЧАСТИЧНОЙ ГАРАНТИИ ИЛИ ТОВАРНОЙ ГАРАНТИИ. ГАРАНТИЯ В ОТНОШЕНИИ КОНСТРУКЦИИ, СОСТОЯНИЯ ИЛИ КАЧЕСТВА МАТЕРИАЛОВ И РАБОТЫ ПОКУПАТЕЛЮ ТОВАРА И / ИЛИ ЛЮБОМУ ЛЮБОМУ ЛИЦУ. НИЧЕГО НЕ СОДЕРЖИТСЯ В ВЫШЕ ПРЕДЛОЖЕНИЯ, НЕ ПРЕДНАЗНАЧЕНА ДЛЯ ОСВОБОЖДЕНИЯ ПРОДАВЦА ОТ ОТВЕТСТВЕННОСТИ ЗА ОБЫЧНЫЙ УЩЕРБ ПО ДОКАЗАННЫМ ПРЕТЕНЗИЯМ ОБ ОТВЕТСТВЕННОСТИ ЗА ПРОДУКТ.

13.3. Обратите внимание, что законы некоторых штатов не допускают ограничения подразумеваемых гарантий или исключения или ограничения определенных убытков. Если вы являетесь резидентом такого штата и к вам применяются эти законы, некоторые или все из вышеперечисленных отказов, исключений или ограничений могут не применяться к вам, и у вас могут быть дополнительные права.

  1. Зарезервированные права. Компания оставляет за собой право делать любое из следующего, по любой причине, в любое время без предварительного уведомления: (1) изменять, приостанавливать или прекращать работу или доступ к Сайтам или любой их части; (2) для модификации или изменения Сайтов или любой их части, а также любых применимых политик или условий; (3) для прерывания работы Сайтов или любой их части, если это необходимо для выполнения планового или внепланового обслуживания, исправления ошибок или других изменений; и (4) прекратить или ограничить использование вами Сайтов.

  1. ПРЕДУПРЕЖДЕНИЕ: Скалолазание, горы, болдеринг, пешие походы и связанные с ними действия — ПОТЕНЦИАЛЬНО УГРОЗЫ ДЛЯ ЖИЗНИ, ОПАСНЫЕ И ОПАСНЫЕ. Приобретая или используя любое оборудование Компании любым способом, вы соглашаетесь с тем, что вы: (1) лично и единолично несете ответственность за: (a) изучение и знание ограничений и возможностей оборудования и себя, (b) правильное использование и методы для такого оборудования, (c) принятие ответственных, разумных решений в меняющихся ситуациях и (2) принятие на себя всех рисков и принятие полной и полной ответственности за любой ущерб и травмы любого рода себе или другим, включая смерть, паралич, а также серьезные травмы, которые могут возникнуть в результате или связаны с использованием вами любого оборудования, произведенного или приобретенного Компанией, ее партнеров, веб-сайтов или розничных продавцов.Кроме того, ВЫ СОГЛАШАЕТЕСЬ ПРИНЯТЬ ВСЕ РИСКИ И ПРИНИМАЕТЕ ПОЛНУЮ И ПОЛНУЮ ОТВЕТСТВЕННОСТЬ ЗА ЛЮБЫЕ УБЫТКИ И ТРАВМЫ ЛЮБОГО РОДА, ВКЛЮЧАЯ СМЕРТЬ, ПАРАЛИЗ И СЕРЬЕЗНЫЕ ТРАВМЫ, КОТОРЫЕ МОГУТ ПРИВЕСТИ К ЛЮБОМУ ИЛИ СВЯЗАННОМ С ВАМИ МАТЕРИАЛЫ ИЛИ ИНФОРМАЦИЯ, СОЗДАННАЯ КОМПАНИЕЙ , ЕЕ ПАРТНЕРАМИ И / ИЛИ СОДЕРЖАЩАЯСЯ НА ЛЮБЫХ ВЕБ-САЙТАХ, КАТАЛОГАХ, ПУБЛИКАЦИЯХ КОМПАНИИ ИЛИ ДРУГИХ МАТЕРИАЛАХ КОМПАНИИ. Такие ресурсы, как веб-сайты и публикации Компании, могут содержать полезную информацию и советы, но они не заменяют правильного принятия решений, безопасного и надлежащего использования оборудования или профессиональных инструкций по многочисленным опасным ситуациям, в которых вы можете использовать продукты Компании.

  1. Раскрытие вашей информации. Вы соглашаетесь, и Компания оставляет за собой право в любое время и без дальнейшего уведомления раскрывать любую информацию, которую Компания сочтет необходимой для соблюдения любого применимого закона, постановления, административного или юридического процесса или правительственного запроса. Компания также может раскрыть вашу информацию, когда Компания определит, что применимое законодательство требует или разрешает такое раскрытие, включая обмен информацией с другими компаниями и организациями в целях защиты от мошенничества.Вы соглашаетесь с тем, что Компания может раскрыть любую имеющуюся у нас информацию о вас (включая вашу личность), если Компания определит, что такое раскрытие необходимо в связи с любым расследованием или жалобой относительно использования вами Веб-сайтов, или для идентификации, связи или возбуждения судебного иска против кого-либо. которые могут причинять вред или вмешиваться, намеренно или непреднамеренно, Веб-сайтам, правам или собственности Компании, или правам или собственности пользователей Веб-сайтов, включая клиентов Компании.Вы признаете и соглашаетесь с тем, что Компания может сохранять любые ваши передачи или сообщения, включая электронные письма, через Веб-сайты или любую услугу, предлагаемую на Веб-сайтах или через Веб-сайты, а также может раскрывать такие данные, если это требуется по закону или Компания определяет, что такое сохранение или раскрытие обоснованно необходимо для (1) соблюдения судебного процесса, (2) обеспечения соблюдения настоящих Условий, (3) ответа на претензии о том, что любые такие данные нарушают права других лиц, и / или (4) защиты прав, собственности или личных безопасность Компании, ее сотрудников, пользователей или посетителей Сайтов и общественности.

  1. Возмещение . ВЫ СОГЛАШАЕТЕСЬ ОБЕСПЕЧИТЬ ЗАЩИТУ, ВОЗМЕЩЕНИЕ И ДЕЯТЕЛЬНОСТЬ КОМПАНИИ, ЕЕ ПРЕЕМНИКОВ, ПЕРЕДАЧ, ЕЕ И ИХ ДИРЕКТОРОВ, ДОЛЖНОСТНЫХ ЛИЦ, СОТРУДНИКОВ, АГЕНТОВ, СО-БРЕНДЕРОВ ИЛИ ДРУГИХ ПАРТНЕРОВ, БЕЗ ВРЕДА ОТ ЛЮБЫХ ТРЕБОВАНИЙ, УЩЕРБА, ИЛИ УБЫТКОВ, ОТВЕТСТВЕННОСТИ (ВКЛЮЧАЯ ПЛАТЕЖИ И СУДЕБНЫЕ РЕШЕНИЯ ЛЮБОГО ВИДА ИЛИ ХАРАКТЕРА), СДЕЛАННЫЕ ПРОТИВ КОМПАНИИ ИЛИ СОВЕРШЕННЫЕ ВАМИ, ЛЮБЫМ ЛИЦОМ ИЛИ ЛИЦОМ, ДЕЙСТВУЮЩИМ ОТ ВАШЕГО ИМЕНИ, И / ИЛИ ЛЮБОЙ ТРЕТЬЕЙ СТОРОНОЙ, СВЯЗАННОЙ С ВАМИ, ВОЗНИКАЮЩЕЙ ИЛИ В СВЯЗИ С ВАМИ НЕПРАВИЛЬНОЕ ИСПОЛЬЗОВАНИЕ ВЕБ-САЙТОВ, НАРУШЕНИЕ ВАМИ ЛЮБОГО ИЗ ДАННЫХ УСЛОВИЙ И / ИЛИ ЛЮБЫЕ ДРУГИЕ НАРУШЕНИЯ ВАМИ, КОТОРЫЕ СОЗДАЮТ ОТВЕТСТВЕННОСТЬ ДЛЯ КОМПАНИИ.Это положение может быть не имеющим исковой силы или неприменимым в штате Нью-Джерси и других штатах.

  1. Применимое право; Разрешение спора; Арбитраж; Отказ от присяжных и коллективных исков; Прочие положения. Посещая или используя любые веб-сайты компании, вы соглашаетесь с тем, что:

(1) Все вопросы, связанные с настоящими Условиями, и / или ваш доступ к Сайтам или их использование, включая все споры, будут регулироваться законами США и законами штата Колорадо без учета его коллизионные нормы.

(2) В случае каких-либо разногласий или споров между Компанией и вами, возникающих из или в связи с настоящими Условиями и / или использованием вами Веб-сайтов, Компания и вы должны попытаться, быстро и добросовестно разрешить любые такие спор. Если мы не можем разрешить любой такой спор в течение тридцати (30) дней, то любая из сторон может потребовать урегулирования такого разногласия или спора посредником. Посредничество может проводиться лично, путем подачи документов, по телефону или через Интернет. Если медиация проводится лично, она будет проходить в Боулдере, штат Колорадо.Если спор не разрешен посредством посредничества в разумные сроки (не превышающие шестидесяти (60) дней с момента запроса о посредничестве), то стороны могут воспользоваться любым правом или средством правовой защиты, доступным им в соответствии с применимым законодательством, посредством обязательного арбитража, как описано ниже.

(3) ОБЯЗАТЕЛЬНЫЙ АРБИТРАЖ: в случае любого спора, возникающего в соответствии с настоящими Условиями или в связи с ними, ваш доступ к Веб-сайтам или их использование (включая продукты или услуги, продаваемые или распространяемые Компанией через Веб-сайты Компании), такой спор будет окончательным и окончательным. разрешается исключительно путем обязательного арбитража.НИ ВЫ, НИ МЫ НЕ ИМЕЕМ ПРАВА НА РАЗРЕШЕНИЕ ЛЮБОЙ ПРЕТЕНЗИИ В СУДЕ ИЛИ НА РЕШЕНИЕ ПРЕТЕНЗИИ СУДЬЕМ ИЛИ ПРИСЯЖНЫМИ СЕССИЯМИ. ПРАВА НА ОБНАРУЖЕНИЕ, ТАКЖЕ, КАК ПРАВО КАЖДОЙ СТОРОНЫ НА ОБМЕН ПРЕДВАРИТЕЛЬНОЙ ИНФОРМАЦИЕЙ ИЛИ ПРЕДВАРИТЕЛЬНОЕ ПРИНЯТИЕ СКАЗАННЫХ СВИДЕТЕЛЬСТВ, ТАКЖЕ МОГУТ БЫТЬ ОГРАНИЧЕНЫ В АРБИТРАЖЕ. Все споры будут разрешаться нейтральным арбитром, решение которого будет окончательным, за исключением ограниченного права на апелляцию в соответствии с Федеральным законом об арбитраже. Арбитраж начинается и проводится в соответствии с Правилами коммерческого арбитража Американской арбитражной ассоциации (AAA) и, при необходимости, Правилами потребительского арбитража AAA, которые доступны на веб-сайте AAA www.adr.org. Арбитражное разбирательство может проводиться лично, путем подачи документов, по телефону или через Интернет по усмотрению Компании. Если арбитраж проводится лично, арбитраж будет проходить в Боулдере, штат Колорадо. Стороны могут подать иск в суд для принуждения к арбитражу, приостановить производство в ожидании арбитража или подтвердить, изменить, отменить или вынести решение по решению, вынесенному арбитром. К настоящим Условиям применяются Федеральный закон об арбитраже и Федеральный закон об арбитраже.

(4) ОТКАЗ ОТ КЛАССА: Любой арбитраж или разбирательство ограничиваются спором между вами и нами в индивидуальном порядке. В полной мере, разрешенной законом, (а) никакое арбитражное разбирательство или судебное разбирательство не может быть объединено с каким-либо другим; (b) не должно быть права или полномочий для арбитража или разрешения любого спора на основе коллективного иска или использования процедур коллективного иска; и (c) не должно быть никаких прав или полномочий для возбуждения какого-либо спора в предполагаемом представительском качестве от имени широкой общественности или любых других лиц.ВЫ СОГЛАШАЕТЕСЬ, ЧТО ВЫ МОЖЕТЕ ПОДАТЬ ПРЕТЕНЗИИ К НАМ ТОЛЬКО В СВОЕМ ЛИЧНОМ ВОЗМОЖНОСТИ, А НЕ В КАЧЕСТВЕ ОБЩЕСТВЕННОГО ИЛИ КЛАССНОГО ЧЛЕНА В ЛЮБОМ ПРЕДПОЛАГАЕМОМ КЛАССЕ ИЛИ ПРЕДСТАВИТЕЛЬСКОМ ПРОЦЕССЕ.

(5) Настоящим вы безоговорочно отказываетесь в максимальной степени, разрешенной законом, (а) от любых возражений, которые у вас могут быть сейчас или в будущем в отношении такой юрисдикции и места проведения, и (b) от любых претензий, что любое такое арбитражное разбирательство было возбуждено в неудобный форум. Обратите внимание, что предыдущее положение относительно места проведения может не применяться, если вы являетесь потребителем, проживающим в Европейском Союзе, однако во всех случаях Конвенция Организации Объединенных Наций о договорах международной купли-продажи товаров не применяется в любых спорах, возникающих из или связанных к настоящим Условиям;

(6) Любые и все претензии, вытекающие из настоящих Условий или связанные с ними, должны быть предъявлены вами в течение одного (1) года после возникновения основания для иска, или такое требование или основание иска навсегда и безвозвратно запрещено.Претензии, предъявленные в соответствии с отдельными условиями покупки товаров и услуг, не подпадают под это ограничение.

(7) Вы не можете требовать или получать компенсацию в отношении Компании за ущерб, кроме ваших личных расходов, за исключением гонораров адвокатов.

(8) Печатная версия настоящих Условий и любого уведомления, предоставленного в электронной форме, допустима в любом посредническом или арбитражном разбирательстве, основанном на настоящих Условиях или связанных с ними, в той же степени и на тех же условиях, что и другие деловые документы и записи. изначально создается и хранится в печатном виде.Все заголовки в настоящих Условиях предназначены только для удобства или для справки и должны игнорироваться при толковании настоящих Условий.

(9) Неспособность Компании обеспечить соблюдение всех или любой части настоящих Условий или отреагировать на их нарушение вами или любой другой стороной никоим образом не должно толковаться как отказ или отказ от любого права, предоставленного Компанией по настоящему Соглашению, в отношении будущих результатов всех или любой части настоящих Условий, и ваши обязательства, изложенные в настоящих Условиях, остаются в полной силе и действии.

(10) Если какое-либо положение настоящих Условий будет признано недействительным или не имеющим исковой силы в соответствии с применимым законодательством, недействительное или неисполнимое положение будет изменено до минимально необходимой степени и будет считаться замененным действующим, имеющим исковую силу положением, которое наиболее точно соответствует намерению оригинала. положение и остальные положения настоящих Условий будут оставаться в полной силе и действии.

(11) Настоящие Условия содержат полное и окончательное соглашение в отношении Веб-сайтов Компании и их Контента и заменяют собой любые предшествующие или одновременные сообщения между вами и Компанией относительно Веб-сайтов.

(12) Любое предложение любой функции, продукта или услуги, сделанное на Веб-сайтах, является недействительным там, где это запрещено. Если вы выбираете доступ к Веб-сайтам из-за пределов США, вы несете единоличную ответственность за соблюдение применимых законов США и местного законодательства. Хотя веб-сайты могут быть доступны по всему миру, не все продукты или функции, предоставляемые или предлагаемые на веб-сайтах, доступны во всех географических точках или доступны (на законных или иных основаниях) для использования за пределами США. Компания оставляет за собой право ограничивать по своему усмотрению. , предоставление и количество любого продукта или функции, показанной на веб-сайтах, любому лицу или географическому региону.

(13) Все права, явно не предоставленные в настоящих Условиях, настоящим сохраняются за Компанией.

(14) Продолжая использовать веб-сайты Компании, вы тем самым соглашаетесь и намереваетесь соблюдать настоящие Условия.

Политика конфиденциальности

Какую информацию мы собираем?

Мы собираем информацию от вас, когда вы регистрируетесь на сайте, размещаете заказ, участвуете в конкурсе или розыгрыше, отвечаете на опрос или сообщение, такое как электронная почта, или участвуете в другой функции сайта. При заказе или регистрации мы можем попросить вас указать ваше имя, адрес электронной почты, почтовый адрес, номер телефона, информацию о кредитной карте или другую информацию.Впрочем, Вы можете посетить наш сайт анонимно. Мы также собираем информацию о получателях подарков, чтобы мы могли совершить покупку подарка. Информация, которую мы собираем о получателях подарков, не используется в маркетинговых целях. Как и многие веб-сайты, мы используем файлы cookie для улучшения вашего опыта и сбора информации о посетителях и посещениях наших веб-сайтов. Пожалуйста, обратитесь к разделу «Используем ли мы файлы cookie?» раздел ниже для получения информации о файлах cookie и о том, как мы их используем.

Как мы используем вашу информацию?

Мы можем использовать информацию, которую мы получаем от вас, когда вы регистрируетесь, покупаете продукты, участвуете в конкурсе или рекламной акции, отвечаете на опрос или маркетинговые сообщения, просматриваете веб-сайт или используете некоторые другие функции сайта следующими способами: Для персонализации вашего сайта опыт и позволить нам предоставлять тот тип контента и продуктовые предложения, которые вас больше всего интересуют.Чтобы мы могли лучше обслуживать вас, отвечая на ваши запросы в службу поддержки. Чтобы быстро обрабатывать ваши транзакции. Для управления конкурсом, продвижением, опросом или другой функцией сайта. Если вы согласились получать нашу рассылку новостей по электронной почте, мы можем отправлять вам периодические электронные письма. Если вы больше не хотите получать от нас рекламные сообщения по электронной почте, обратитесь к разделу «Как вы можете отказаться, удалить или изменить информацию, которую вы нам предоставили?» раздел ниже. Если вы не подписались на получение информационных бюллетеней по электронной почте, вы не будете получать эти электронные письма.Посетителям, которые регистрируются или участвуют в других функциях сайта, таких как маркетинговые программы и контент, предназначенный только для участников, будет предоставлен выбор, хотят ли они быть в нашем списке электронной почты и получать от нас сообщения электронной почты.

Как мы защищаем информацию о посетителях?

Мы применяем различные меры безопасности для обеспечения безопасности вашей личной информации. Ваша личная информация хранится в защищенных сетях и доступна только ограниченному числу лиц, которые имеют особые права доступа к таким системам и обязаны сохранять конфиденциальность информации.Когда вы размещаете заказы или получаете доступ к своей личной информации, мы предлагаем использовать безопасный сервер. Вся конфиденциальная / кредитная информация, которую вы предоставляете, передается с помощью технологии Secure Socket Layer (SSL), а затем зашифровывается в наших базах данных, чтобы к ней можно было получить доступ только так, как указано выше.

Используем ли мы «куки»?

Да. Файлы cookie — это небольшие файлы, которые сайт или его поставщик услуг передает на жесткий диск вашего компьютера через ваш веб-браузер (если вы разрешаете), что позволяет системам сайта или поставщика услуг распознавать ваш браузер и захватывать и запоминать определенную информацию.Например, мы используем файлы cookie, чтобы запоминать и обрабатывать товары в вашей корзине покупок. Они также используются, чтобы помочь нам понять ваши предпочтения на основе предыдущей или текущей активности на сайте, что позволяет нам предоставлять вам улучшенные услуги. Мы также используем файлы cookie, чтобы помочь нам собрать агрегированные данные о посещаемости и взаимодействии с сайтом, чтобы в будущем мы могли предлагать лучший опыт и инструменты для работы с сайтом. Мы можем заключать договор со сторонними поставщиками услуг, чтобы помочь нам лучше понять посетителей нашего сайта.Этим поставщикам услуг не разрешается использовать информацию, собранную от нашего имени, кроме как для помощи нам в ведении и улучшении нашего бизнеса. Вы можете выбрать, чтобы ваш компьютер предупреждал вас каждый раз, когда отправляется файл cookie, или вы можете отключить все файлы cookie. Вы делаете это через настройки вашего браузера (например, Netscape Navigator или Internet Explorer). Каждый браузер немного отличается, поэтому посмотрите в меню «Справка» своего браузера, как правильно изменять файлы cookie. Если вы отключите файлы cookie, у вас не будет доступа ко многим функциям, которые сделают ваш сайт более эффективным, а некоторые из наших услуг не будут работать должным образом.Однако вы все равно можете размещать заказы по телефону, связавшись со службой поддержки клиентов.

Раскрываем ли мы собираемую информацию третьим лицам?

Мы не продаем, не обмениваем или иным образом не передаем третьим лицам вашу личную информацию, если мы не предоставим вам предварительное уведомление, за исключением случаев, описанных ниже. Термин «внешние стороны» не распространяется на наш бизнес. Сюда также не входят партнеры по хостингу веб-сайтов и другие стороны, которые помогают нам в эксплуатации нашего веб-сайта, ведении нашего бизнеса или обслуживании вас, при условии, что эти стороны соглашаются сохранять конфиденциальность этой информации.Мы также можем раскрыть вашу информацию, если мы считаем, что это необходимо для соблюдения закона, обеспечения соблюдения политик нашего сайта или защиты наших или других прав, собственности или безопасности. Однако информация о посетителях, не позволяющая установить личность, может быть предоставлена ​​другим сторонам для маркетинговых, рекламных или других целей.

Как вы можете отказаться, удалить или изменить информацию, которую вы нам предоставили?

Чтобы изменить подписку по электронной почте, сообщите нам об этом, изменив свои настройки в разделе «Моя учетная запись».Обратите внимание, что из-за графиков создания электронной почты вы можете получать любые электронные письма, которые уже находятся в разработке. Чтобы удалить всю информацию о своей учетной записи в Интернете из нашей базы данных, войдите в раздел «Моя учетная запись» на нашем сайте и удалите адреса доставки, адреса для выставления счетов и платежную информацию. Обратите внимание, что мы можем хранить информацию об отдельной сделке купли-продажи, чтобы обслуживать эту транзакцию и вести учет.

Сторонние ссылки

В попытке предоставить вам повышенную ценность мы можем включать на наш сайт сторонние ссылки.Эти веб-узлы имеют отдельные и независимые политики конфиденциальности. Поэтому мы не несем ответственности за содержание и деятельность этих сайтов, на которые есть ссылки. Тем не менее, мы стремимся защитить целостность нашего сайта и приветствуем любые отзывы об этих связанных сайтах (в том числе, если конкретная ссылка не работает).

Изменения в нашей политике

Если мы решим изменить нашу политику конфиденциальности, мы опубликуем эти изменения на этой странице. Изменения политики будут применяться только к информации, собранной после даты изменения.В эту политику в последний раз вносились изменения 27 сентября 2014 г.

Вопросы и отзывы

Мы приветствуем ваши вопросы, комментарии и опасения по поводу конфиденциальности. Пожалуйста, присылайте нам любые отзывы, касающиеся конфиденциальности или любой другой проблемы.

Только онлайн-политика

Настоящая политика конфиденциальности в Интернете применяется только к информации, собранной через наш веб-сайт, а не к информации, собранной в автономном режиме.

5 причин перейти на органическую настойку CBD в 2021 году

При покупках для новой настойки CBD, вы, вероятно, учитываете сразу несколько вещей, потому что вы знайте, что не все продукты из конопли созданы одинаково.Вы ищете надежный бренд, правильная концентрация в миллиграммах, потрясающий вкус и правильный вид экстракта конопли, среди прочего. Однако есть еще один важный фактор часто упускается из виду — органический.

Что делает настойку CBD органической?

Чтобы настойка CBD называлась «органической», ферма, на которой была получена конопля, должна быть сертифицирована Организацией Объединенных Наций как органическая. Департамент сельского хозяйства штата (USDA). Конопля может быть сертифицирована как органическая, только если она соответствует чрезвычайно строгим критериям, которые включают условия, в которых конопля выращивалась.

Почему не все компании / производители КБР делают органические настойки?

Если органические продукты всегда лучше, зачем их так много? компании используют КБР, выращенный традиционным способом? Что ж, здесь работают несколько ключевых моментов:

  • Получение органического сертификата не является обязательным. всегда простой процесс, потому что:
  • -Это может занять некоторое время сертификат.
  • -Это может потребовать некоторых финансовых ресурсов для быть протестированным Министерством сельского хозяйства США в первую очередь.
  • Многим компаниям из КБР просто все равно. Как придешь? Поскольку конопля сейчас является массовым трендом, существует множество брендов. которые просто хотят заработать на быстрорастущем рынке, и они срезают углы, чтобы увеличить свою прибыль.

5 причин переходить на органические продукты в процессе покупки настойки CBD

Теперь давайте обсудим, почему органические продукты всегда лучше, когда речь идет о настойках CBD.

Причина № 1: Отсутствие пестицидов

Пестициды — известные токсины, которые могут разрушать различные системы организма при слишком частом употреблении.Они используются для защиты сельскохозяйственных культур от вредителей, но это может быть дорого обходится потребителям. Конопля уникальный абсорбент, а это значит, что он очень хорошо выводит токсины из окружающая почва. Вот почему это так Очень важно, чтобы конопля выращивалась в среде, свободной от пестицидов.

Причина № 2: Менее вероятно содержание тяжелых металлов

Другой тип токсина, который может попасть в растения конопли через почву проходят тяжелые металлы. Тяжелый металлы могут проникать в почву и попадать в растительный материал.Их, как и пестицидов, следует избегать. по возможности из-за их потенциального негативного воздействия на здоровье. Органически выращенная конопля гораздо реже содержат тяжелые металлы, чем те, которые выращиваются традиционным способом.

Причина № 3: демонстрирует приверженность компании качеству

Еще одна вещь, о которой следует помнить, — это то, что при совершении покупок для CBD, вы хотите найти компанию, которая делает все возможное, чтобы доставить качественная продукция.Видя, если они использование органической конопли — отличный показатель того, что они стремятся к превосходному методы производства, а это означает, что продукт с большей вероятностью даст вам желаемые результаты.

Причина № 4: Может быть более химически стабильной

Весьма вероятно, что органическая конопля может дать больше химически стабильный конечный продукт. Это потому что некоторые токсины могут ускорить процесс образования соединений в конопле. ломается, а это значит, что к тому моменту, когда товар попадет вам в руки, он очень уязвим к химической нестабильности, вызванной определенными экологическими факторы.Продукт, который химически нестабильный может испортиться и потерять свою эффективность до истечения срока годности. прибыл, что может привести к потере значительной суммы денег при наслаждаясь менее чем звездным опытом конопли.

Причина № 5: Может быть, вкуснее

CBD, полученный из органической конопли, может иметь очиститель и более приятный вкус. Это потому что в нем нет примесей, которые могут повлиять на вкус молекулы.

Как узнать, производит ли компания CBD органические настойки?

Большинство компаний, которые это делают, с гордостью заявят об этом на описание продукта или этикетка. Но, к сожалению, не все компании. Вы определенно можете связаться с брендом через их службу поддержки. свяжитесь, чтобы спросить их сами. Любая компания CBD, которая изо всех сил старается производить органические продукты должны быть более чем готовы поделиться этой информацией с потребителями, когда их спросят.

Еще одна вещь, которая может помочь вам определить органическое статус настойки CBD — это лабораторные отчеты. Любая заслуживающая доверия компания по производству конопли отображает отчеты своих лабораторий на своих Веб-сайт. Эти лабораторные отчеты получены из сторонний центр тестирования, и они ломают все важные информация об экстракте конопли, используемом компанией. Эти отчеты беспристрастны, поэтому вы можете доверять от всего сердца.

Во многих лабораторных отчетах CBD будет указано, является ли конопля Экстракт происходит из органического растительного материала.Если это не так, вы можете найти эту информацию в другом месте. Во всех лабораторных отчетах указано возможное присутствие примесей, таких как тяжелые металлы и пестициды. Если вы видите, что эти примеси присутствуют в экстракте конопли, даже в следах количества, которые могут показать вам, что конопля не была выращена органическим способом.

Где можно найти органические настойки CBD?

Может быть, вы просто не хотите тратить весь день на поиск Интернет для органических настоек. Что ж, если это так, вы в поисках.В Vape Mall мы упрощаем вам задачу найти именно то, что вы ищете, потому что мы предлагаем хороший выбор органические настойки CBD, обозначенные как таковые. Вы обнаружите, что наш выбор органических настоек CBD велик и разнообразны, что поможет вам найти именно то, что вы ищете. Они бывают в широком диапазоне миллиграммов. сильные стороны, составы и экстракты конопли, поэтому у вас не будет проблем с выбором продукт, который наилучшим образом отражает ваши цели и потребности.

Как видите, органические настойки CBD легко лучше, чем из конопли, выращенной обычным способом. Итак, в следующий раз, когда вы пойдете в магазин за новым настойку, обязательно проверьте наличие доказательств того, что она была изготовлена ​​с использованием органических культур.

Как получить выписку из реестра через Интернет?

Как получить выписку из Единого государственного реестра юридических лиц через Интернет?

  • Также могу порекомендовать услугу, с помощью которой можно получить электронную выписку из реестра онлайн -.Стоимость электронной выписки из Единого государственного реестра юридических лиц — 150 рублей .

  • В налоговой службе есть услуга, позволяющая получить выписку прямо из ЕГРЮЛ или ЕГРИП. Услуга доступна в электронном виде для индивидуальных предпринимателей и юридических лиц. Вы можете получить эту выписку на сайте налоговой службы. Москвичи могут заказать выписку с печатью до ближайшей станции метро, ​​услуга 1000 рублей стоит

  • Нашла в сети круглосуточную услугу предоставления выписок из Единого государственного реестра юридических лиц онлайн.Быстро и недорого — ссылка здесь.

  • Получить выписку из Единого государственного реестра юридических лиц можно через обычный Интернет, не выходя из дома. Разумеется, эта выписка не будет иметь юридической силы и будет носить исключительно информационный характер — это важно знать. Итак, выписку можно получить на этом сайте.

  • Получить бесплатно выписку из реестра через Интернет можно получить по запросу на сайте Федеральной налоговой службы.

    Для получения выписки необходимо создать новое приложение, в котором нужно указать ОГРН или ОГРНП, информация о котором необходима, и способ получения выписки.

    • в электронном виде — через Интернет
    • на бумаге — с личным обращением заявителя в налоговый орган или по почте.

    Выписка в электронном виде создается в виде файла Excel и включает только общедоступную информацию (без паспортных данных, адресов физических лиц и информации о банковских счетах).

    Заявление на бумаге нумеруется, прошивается, подписывается должностным лицом налогового органа) и выдается (отправляется по почте) заявителю.

    Необходимо знать, что выписка из Единого государственного реестра юридических лиц, полученная через Интернет, не имеет юридической силы, так как не заверена печатью налогового органа. В налоговой говорят, что заверяют только те заявления, которые печатают сами.

    Пс. Хотя, как и сведения о юрлице, совершенно недостоверны.Приходит, как правило, в течение нескольких часов.

  • В настоящее время получить Единое государственное регистрационное заявление можно через Интернет. Для этого нужно зайти на официальный сайт налоговой, найти его можно здесь по этой ссылке, там подробно описано, что и как делать.

  • В нашем 21 веке все можно делать через Интернет. Согласитесь, зачем бегать и что-то искать, если в сети все можно делать? Не так давно воспользовался службой ФНС по Москве.Вот где я посмотрел интересующую меня информацию, потратив на нее не более 10 минут. Я также заказал выписку, которую прислали мне по почте.

  • Да, вы можете получить выписку из Единого государственного реестра юридических лиц через Интернет, и вы можете получить выписку как информацию о несертифицированном налоге, но вы можете получить выписку из Единого государственного реестра единых предпринимателей через Интернет, который будет заверен налоговой службой электронной цифровой подписью.Такая выписка аналогична выписке из Единого государственного реестра юридических услуг на бумажном носителе с подписью и печатью проверки.

    Для получения такой выписки необходимо перейти на официальный сайт https://service.nalog.ru/vyp/, затем зарегистрироваться в сервисе и запросить выписку из Единого государственного реестра юридических лиц. , с указанием ИНН или ОГРН. Через какое-то время (не более суток) придет выписка, которая будет заверена подписью инспекции.

    Кстати, такую ​​выписку можно заказать не только из Единого реестра юридических лиц, но и из ЕГР (для индивидуальных предпринимателей).

  • Если заказать выписку из Единого государственного реестра юридических лиц через Интернет в электронном виде, то такая выписка не будет иметь юридической силы, как распечатанный документ, оформленный от руки. Однако бывают ситуации, когда все же нужно быстро получить выписку из Учреждения, а это можно сделать за 5 минут.Заказывал это заявление через портал гос. Сервисы. (Считаю этот вариант более надежным).

    Также можно получить через сайт Федеральной налоговой службы., На специализированных сайтах, специализирующихся на выдаче такой информации в режиме онлайн:

    • бизнес-центры
    • Проверьте себя и контрагента
    • и другую компанию-посредника.
  • Сегодня получить выписку из реестра можно тремя разными способами.

  • Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *